Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 30 Oct 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL200e22.3                           12 END     1          14        8                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:5161889.5                       8 END     1          14       12                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6630729-IMAGp.5.5              12 PI      77        387      708                hypothetical protein LOC100145687 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012790028 Xl3.1-IMAGE:5512667.5 - 7 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     5     6     6     6     4     6     4     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     2     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 4e-030     NP_508865.1 friend leukemia integration 1 like (XF694) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================
                                                                                      PROTEIN --- Ag ---- 2e-050     XP_557464.3 AGAP004619-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-054     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-060     NP_001071702.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN --- Sp ---- 8e-061     NP_999698.1 ets homolog [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Dr ---- 1e-076     NP_001018874.1 hypothetical protein LOC326672 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 2e-130     NP_035938.2 E26 avian leukemia oncogene 1, 5' domain isoform 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bt ---- 1e-130     NP_001092576.1 v-ets erythroblastosis virus E26 oncogene homolog 1 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 3e-132     XP_001231221.1 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Cf ---- 3e-132     XP_546405.2 PREDICTED: similar to v-ets erythroblastosis virus E26 oncogene homolog 1 isoform 1 [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 1e-132     NP_005229.1 v-ets erythroblastosis virus E26 oncogene homolog 1; Avian erythroblastosisvirus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1;v-ets erythroblastosis virus [Homo sapiens]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ---- 1e-143     NP_001081621.1 c-ets-1b proto-oncogene [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5512667.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TAG---------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------TGA---------------ATG---------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TAG------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       bld Emb1                            IMAGE:5154923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGGAAGAGCTCTTGTCTTTGAAATATGAGAGCGACTACCCTTTAGGACTGCTGCGTGACCCCCTGCAGCCTGAATCTCTTCAAGGCGACTACTTCACCATCAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGAGGGCAGGAGTCCTTTGAAAGTATTGAGAGCCATGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCCTACAACAGCCTTCAACGTGTGCCATCTTATGACAGTTTTGATTCTGAGGACTACCCACCTGCTTTGCCCAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCAGAACTCAACAAAGACAAACCCGTCATCCCTGCTGCTGCTCTCGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTGCTGACAGACAAATCGTGCCAGTCCTTTATTAGCTGGACAGGTGATGGCTGGGAATTTAAACTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGCAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGACTGCGCTATTACTATGACAAAAATATCATTCACAAAACAGCAGGAAAGCGCTACGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTTGGATATGTGCCGGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGAAAAAAATAGGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACT
  5   1   1       add Tbd7      out                        XL063j19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTCTAGGACTGCTGCGTGACCCCCTGCAGCCTGAATCTCTTCAGGGCGACTACTTCACCATCAAACAGGAGGTAGTGACTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAGTCCTTTGAAAGTATTGAGAGCCATGACAGCTGTGACCGCCTCACACAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGTTTTGATTCGGAAGACTACCCACCTGCTATGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCGGAACTCAACAAAGACAAACCTGTCATCCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGCGGACCAATTCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGATGGCTGGGAATTTAAGCTGTCTGATCCA
  5   1   2       bld Sp1                             IMAGE:5512667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAGCAGAACTCAACATAGACAAACCCGTCATCCCTGCTGCTGCTCTCGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTGCTGACAGACAAATCGTGCCAGTCCTTTATTAGCTGGACAGGTGATGGCTGGGAATTTAAACTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGCAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGACTGCGCTATTACTATGACAAAAATATCATTCACAAAACAGCAGGAAAGCGCTACGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTTGGATATGTGCCGGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGaaaaaaaaTAAGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCCGCACCTACTTTTTATGCAGAACAGGAAGGAGAGNCATTTGATTTTGCTACTTAGTAACCATTNTATTNCCAGATGTGTGCCAGTATGTCATATAttttttttttCTGAATTAGTGGATTTTTTNGCTCAGNNTCTGTTCATGTGTAGCCAGCTTTATN
  5   1   2       add Ga12                                 XL165m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGATGGCTGGGAATTTAAGCTGTCTGATCCAGATGAGGTTGCAAGACGCTGGGGAAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGTCGTGGGCTCCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGATACGTCTACCGTTTTGTATGCGACTTACAAAGTCTTCTGGGATATGTACCAGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGACAGAAGTATGGAGCAAAGAAAAAGACAAAAATCCACAAACCCTAATCTCTGCGCCACTTTTTTCCCTCCTGGATGCGCAGGATAGATATGAAGCCTTTGGGGTTAAAGGATATGACTAGAAATGGACACTGCTTAGTTCGTGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCACACCCTACTATTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATAtttttttttCTGAATTAATGCATTTTTTGCTTCAGTCCTTGTTTCATGTGTAG
  5   1   2      seed Neu7      out                        XL034o01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTAAACTCTCTGATCCGATGAGGTTGCAAGACGCTGGGGCAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGACTGCGCTATTACTATGACAAAAATATCATTCACAAAACAGCAGGAAAGCGCTACGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTTGGATATGTGCCGGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGaaaaaaaaTAAGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGCACCCTAC
  5   1   2      skin Neu7                                 XL021i24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGCTTGATGTTAAACCGNACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGaaaaaaaaTAAGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGCACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATGTCATATAttttttttttCTGAATTAGNGGATTTTTTTGCTTCAGTTCTTGTTTCATGTGTAGCCAGCTTTTATCAGCAGATGCAAACTGATACCAATTGTCTGACAGACTACAAAAAAAGAAGGAAGNGTGTTAAGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCTACAAAGATTTTTATGACTTCATTTTGCGGAGCCATATT
  5   1   2       bld Em10                            IMAGE:7979809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGaaaaaaaaTAAGACAACCCACAAACCCCAAGCTCCACTCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGCACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATGTCATATAttttttttttCTGAATTAGTGGATTTTTTTGCTTCAGTTCTTGTTTCATGTGTAGCCAGCTTTTATCAGCAGATGCAAACTGATACCAATTGTCTGACAGACTACAAAAAAAGAAGGAAGTGTGTTAAGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCTACAAAGATTTTTATGACTTCATTTTGCGGAGCCATATTGCTGGAACAATTAATCAGCTTGATTCAAGCCATATCTGAGCATAGTTCTGATGTAGAGGTATTGGTTTAAGTGCTCCTTGTGTCCACGTGGCTGAAGAGATTTTAGAAGTGCTTCAGCTTCTCCGGACACAATAGTAGTACAAATATATCCTTCCTGCTGTACTTGACTTCATTTGAGGACGATCTCAGATAGCTCCCCTTTACTATTCATGTGCTGACACACAATGTGCCTATCCGTACTGCAAATCC

In case of problems mail me! (