Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL200e22.3                           12 END     1          14        8                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:5161889.5                       8 END     1          14       12                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6630729-IMAGp.5.5              12 PI      77        387      708                hypothetical protein LOC100145687 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012790028 Xl3.1-IMAGE:5512667.5 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5512667.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGAAATATGAGAGCGACTACCCTTTAGGACTGCTGCGTGACCCCCTGCAGCCTGAATCTCTTCAAGGCGACTACTTCACCATCAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGAGGGCAGGAGTCCTTTGAAAGTATTGAGAGCCATGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCCTACAACAGCCTTCAACGTGTGCCATCTTATGACAGTTTTGATTCTGAGGACTACCCACCTGCTTTGCCCAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCAGAACTCAACAAAGACAAACCCGTCATCCCTGCTGCTGCTCTCGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTGCTGACAGACAAATCGTGCCAGTCCTTTATTAGCTGGACAGGTGATGGCTGGGAATTTAAACTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGCAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGACTGCGCTATTACTATGACAAAAATATCATTCACAAAACAGCAGGAAAGCGCTACGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTTGGATATGTGCCGGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGAAAAAAAATAAGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGCACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATGTCATATATTTTTTTTTTCTGAATTAGTGGATTTTTTTGCTTCAGTTCTTGTTTCATGTGTAGCCAGCTTTTATCAGCAGATGCAAACTGATACCAATTGTCTGACAGACTACAAAAAAAGAAGGAAGTGTGTTAAGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCTACAAAGATTTTTATGACTTCATTTTGCGGAGC
                                                  Xl3.1-CHK-1012700171                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATATGAGAGCGACTACCCTTTAGGACTGCTGCGTGACCCCCTGCAGCCTGAATCTCTTCAAGGCGACTACTTCACCATCAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGAGGGCAGGAGTCCTTTGAAAGTATTGAGAGCCATGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCCTACAACAGCCTTCAACGTGTGCCATCTTATGACAGTTTTGATTCTGAGGACTACCCACCTGCTTTGCCCAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCAGAACTCAACAAAGACAAACCCGTCATCCCTGCTGCTGCTCTCGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTGCTGACAGACAAATCGTGCCAGTCCTTTATTAGCTGGACAGGTGATGGCTGGGAATTTAAACTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGCAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGACTGCGCTATTACTATGACAAAAATATCATTCACAAAACAGCAGGAAAGCGCTACGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTTGGATATGTGCCGGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGAAAAAAAATAAGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGCACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATGTCATATATTTTTTTTTTCTGAATTAGTGGATTTTTTTGCTTCAGTTCTTGTTTCATGTGTAGCCAGCTTTTATCAGCAGATGCAAACTGATACCAATTGTCTGACAGACTACAAAAAAAGAAGGAAGTGTGTTAAGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCTACAAAGATTTTTATGACTTCATTTTGCGGAGCCATATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     5     6     6     6     4     6     4     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     2     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 4e-030     NP_508865.1 friend leukemia integration 1 like (XF694) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================
                                                                                      PROTEIN --- Ag ---- 2e-050     XP_557464.3 AGAP004619-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-054     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-060     NP_001071702.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN --- Sp ---- 8e-061     NP_999698.1 ets homolog [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Dr ---- 1e-076     NP_001018874.1 hypothetical protein LOC326672 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 2e-130     NP_035938.2 E26 avian leukemia oncogene 1, 5' domain isoform 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bt ---- 1e-130     NP_001092576.1 v-ets erythroblastosis virus E26 oncogene homolog 1 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 3e-132     XP_001231221.1 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Cf ---- 3e-132     XP_546405.2 PREDICTED: similar to v-ets erythroblastosis virus E26 oncogene homolog 1 isoform 1 [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 1e-132     NP_005229.1 v-ets erythroblastosis virus E26 oncogene homolog 1; Avian erythroblastosisvirus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1;v-ets erythroblastosis virus [Homo sapiens]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ---- 1e-143     NP_001081621.1 c-ets-1b proto-oncogene [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5512667.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TAG---------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------TGA---------------ATG---------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TAG------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       bld Emb1                            IMAGE:5154923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGGAAGAGCTCTTGTCTTTGAAATATGAGAGCGACTACCCTTTAGGACTGCTGCGTGACCCCCTGCAGCCTGAATCTCTTCAAGGCGACTACTTCACCATCAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGAGGGCAGGAGTCCTTTGAAAGTATTGAGAGCCATGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCCTACAACAGCCTTCAACGTGTGCCATCTTATGACAGTTTTGATTCTGAGGACTACCCACCTGCTTTGCCCAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCAGAACTCAACAAAGACAAACCCGTCATCCCTGCTGCTGCTCTCGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTGCTGACAGACAAATCGTGCCAGTCCTTTATTAGCTGGACAGGTGATGGCTGGGAATTTAAACTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGCAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGACTGCGCTATTACTATGACAAAAATATCATTCACAAAACAGCAGGAAAGCGCTACGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTTGGATATGTGCCGGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGAAAAAAATAGGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACT
  5   1   1       add Tbd7      out                        XL063j19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTCTAGGACTGCTGCGTGACCCCCTGCAGCCTGAATCTCTTCAGGGCGACTACTTCACCATCAAACAGGAGGTAGTGACTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAGTCCTTTGAAAGTATTGAGAGCCATGACAGCTGTGACCGCCTCACACAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGTTTTGATTCGGAAGACTACCCACCTGCTATGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCGGAACTCAACAAAGACAAACCTGTCATCCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGCGGACCAATTCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGATGGCTGGGAATTTAAGCTGTCTGATCCA
  5   1   2       bld Sp1                             IMAGE:5512667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAGCAGAACTCAACATAGACAAACCCGTCATCCCTGCTGCTGCTCTCGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTGCTGACAGACAAATCGTGCCAGTCCTTTATTAGCTGGACAGGTGATGGCTGGGAATTTAAACTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGCAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGACTGCGCTATTACTATGACAAAAATATCATTCACAAAACAGCAGGAAAGCGCTACGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTTGGATATGTGCCGGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGaaaaaaaaTAAGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCCGCACCTACTTTTTATGCAGAACAGGAAGGAGAGNCATTTGATTTTGCTACTTAGTAACCATTNTATTNCCAGATGTGTGCCAGTATGTCATATAttttttttttCTGAATTAGTGGATTTTTTNGCTCAGNNTCTGTTCATGTGTAGCCAGCTTTATN
  5   1   2       add Ga12                                 XL165m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGATGGCTGGGAATTTAAGCTGTCTGATCCAGATGAGGTTGCAAGACGCTGGGGAAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGTCGTGGGCTCCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGATACGTCTACCGTTTTGTATGCGACTTACAAAGTCTTCTGGGATATGTACCAGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGACAGAAGTATGGAGCAAAGAAAAAGACAAAAATCCACAAACCCTAATCTCTGCGCCACTTTTTTCCCTCCTGGATGCGCAGGATAGATATGAAGCCTTTGGGGTTAAAGGATATGACTAGAAATGGACACTGCTTAGTTCGTGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCACACCCTACTATTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATAtttttttttCTGAATTAATGCATTTTTTGCTTCAGTCCTTGTTTCATGTGTAG
  5   1   2      seed Neu7      out                        XL034o01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTAAACTCTCTGATCCGATGAGGTTGCAAGACGCTGGGGCAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGACTGCGCTATTACTATGACAAAAATATCATTCACAAAACAGCAGGAAAGCGCTACGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTTGGATATGTGCCGGAAGAACTGCACGCCATGCTTGATGTTAAACCAGACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGaaaaaaaaTAAGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGCACCCTAC
  5   1   2      skin Neu7                                 XL021i24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGCTTGATGTTAAACCGNACACTGATGAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGaaaaaaaaTAAGACAACCCACAAACCCCAAGCTCCAATCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGCACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATGTCATATAttttttttttCTGAATTAGNGGATTTTTTTGCTTCAGTTCTTGTTTCATGTGTAGCCAGCTTTTATCAGCAGATGCAAACTGATACCAATTGTCTGACAGACTACAAAAAAAGAAGGAAGNGTGTTAAGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCTACAAAGATTTTTATGACTTCATTTTGCGGAGCCATATT
  5   1   2       bld Em10                            IMAGE:7979809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATAGAGTTTAGTAGATTTAAGTTTGGAGCCTAGaaaaaaaaTAAGACAACCCACAAACCCCAAGCTCCACTCTCTGCGCCACTTTTTTCACTCCTGGATGTGCAGGATTTATATGAAGTCTTTCAGCGTAAAGGATATAACTGGGAAACAGACACTGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACCCTGCATTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGCACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATGTCATATAttttttttttCTGAATTAGTGGATTTTTTTGCTTCAGTTCTTGTTTCATGTGTAGCCAGCTTTTATCAGCAGATGCAAACTGATACCAATTGTCTGACAGACTACAAAAAAAGAAGGAAGTGTGTTAAGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCTACAAAGATTTTTATGACTTCATTTTGCGGAGCCATATTGCTGGAACAATTAATCAGCTTGATTCAAGCCATATCTGAGCATAGTTCTGATGTAGAGGTATTGGTTTAAGTGCTCCTTGTGTCCACGTGGCTGAAGAGATTTTAGAAGTGCTTCAGCTTCTCCGGACACAATAGTAGTACAAATATATCCTTCCTGCTGTACTTGACTTCATTTGAGGACGATCTCAGATAGCTCCCCTTTACTATTCATGTGCTGACACACAATGTGCCTATCCGTACTGCAAATCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)