Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-IMAGE:6948136.3                       6 END     2          66       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl341g04.5                            4 PI      93        431      900                DiGeorge syndrome critical region gene 2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 88%

 1012790054 Xl3.1-IMAGE:6948136.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6948136.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGGGGGGACGGAGGTCGCCATCTTGTTCTCGGCGCTAACTGAGGCTGGCTGCCAACCGGTACCGGAATCCTAGAGCTGAAACATGTCCCTGGAGACCTAATATTTGCGTTATTTGTAGAGAGCGTCAAAGCTCATCCCAGTTTTTCACCACTCCGGCAAAGTGCCCGGTTTTCGCGTCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTTTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTTGCGTGCCACAGTGGTACCATACAGTGTATCCCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGGCTGGAGACCAGCGAACATTTCATGGAAAGGAGAGTGTGGACACACGTTTTAACAGAGGTCGGAATGGGGAAACCCCTCGATTTCATACAGTGAACTTTGCCCAGCCTGTCCGTTTCAGCAGTTTCCTAGGAAAATGTCCATCAGGATGGCATCATTATGAAGGAACAGCCAGCTGTTATAAGGTATACTCATCAGGAGAAAATTACTGGGATGCTGTACAAATATGTCAGAAGGTAAATGGGTCTCTGGCAACCTTCACTACAGACCAGGAGCTGAAATTCATTTTGGCCCAAGAAGTGGGACGTGGCGGAAAGACCATTTGGAAGGAAGGATCAGCTGAGATTGTGGGTTGGCTACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTACCATATAAAGGATCTGCTGAGGTTTTCCTTGCCCCCCGTGCCCATCTTTGGAACGCCCGACAATGAGAATATCTTGTG
                                                  Xl3.1-CHK-1012714269                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGACGGAGGTCGCCATCTTGTTCTCGGCGCTAACTGAGGCTGGCTGCCAACCGGTACCGGAATCCTAGAGCTGAAACATGTCCCTGGAGACCTAATATTTGCGTTATTTGTAGAGAGCGTCAAAGCTCATCCCAGTTTTTCACCACTCCGGCAAAGTGCCCGGTTTTCGCGTCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTTTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTTGCGTGCCACAGTGGTACCATACAGTGTATCCCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGGCTGGAGACCAGCGAACATTTCATGGAAAGGAGAGTGTGGACACACGTTTTAACAGAGGTCGGAATGGGGAAACCCCTCGATTTCATACAGTGAACTTTGCCCAGCCTGTCCGTTTCAGCAGTTTCCTAGGAAAATGTCCATCAGGATGGCATCATTATGAAGGAACAGCCAGCTGTTATAAGGTATACTCATCAGGAGAAAATTACTGGGATGCTGTACAAATATGTCAGAAGGTAAATGGGTCTCTGGCAACCTTCACTACAGACCAGGAGCTGAAATTCATTTTGGCCCAAGAAGTGGGACGTGGCGGAAAGACCATTTGGAAGGAAGGATCAGCTGAGATTGTGGGTTGGCTACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTACCATATAAAGGATCTGCTGAGGTTTTCCTTGCCCCCCGTGCCCATCTTTGGAACGCCCGACAATGAGAATATCTTGTGGCGCCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     206     119                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     116      71                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     206     212                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     206       7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 5e-007     BAE06540.1 low density lipoprotein receptor-related protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 6e-007     NP_001097934.1 LpR1 CG31094-PF, isoform F [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================
                                                                       ...PROTEIN --- Ag ---- 1e-007     XP_320740.4 AGAP011770-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 2e-008     XP_001183337.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------===============================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-011     NP_032539.1 low density lipoprotein receptor-related protein 5 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 9e-012     NP_002326.2 low density lipoprotein receptor-related protein 5 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Dr ==== 2e-062     NP_001122278.1 hypothetical protein LOC799209 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Bt ==== 5e-086     NP_001070504.1 DiGeorge syndrome critical region gene 2 [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Cf ==== 2e-091     XP_543554.2 PREDICTED: similar to Integral membrane protein DGCR2/IDD precursor [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Gg ==== 1e-099     XP_415217.2 PREDICTED: similar to DiGeorge syndrome critical region gene 2 [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 3e-125     CAJ82632.1 DiGeorge syndrome critical region gene 2 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 1e-130     NP_001086166.1 MGC84054 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6948136.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TAAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TGA------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Ga12 5g                              XL188h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGGGGGGACGGAGGTCGCCATCTTGTTCTCGGCGCTAACTGAGGCTGGCTGCCAACCGGTACCGGAATCCTAGAGCTGAAACATGTCCCTGGAGACCTAATATTTGCGTTATTTGTAGAGAGCGTCAAAGCTCATCCCAGTTTTTCACCACTCCGGCAAAGTGCCCGGTTTTCGCGTCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTTTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTTGCGTGCCACAGTGGTACCATACAGTGTATCCCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGGCTGGAGACCAGCGAACATTTCATGGAAAGGAGAGTGTGGACACACGTTTTAACAGAGGTCGGAATGGGGAAACCCCTCGATTTCATACAGTGAACTTTGCCCAGCCTGTCCGTTTCAGCAGTTTCCTAGGAAAATGTCCATCAGGATGGCATCATTATGAAGGAACAGCCAGCTGTTATAAGGTATACTCATCAGGAGAAAATTACTGGGATGCTGTACAAATATGTCAGAANGTAAATGGGTCTCTGGCAACCTTCACTACAGAC
  5   1   2      seed Eye1 5g3  out                   IMAGE:6948136.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACCGGTCCGGAATTCTCGGGATGAGGCTGGCTGCCAACCGGTACCGGAATCCTAGAGCTGAAACATGTCCCTGGAGACCTAATATTTGCGTTATTTGTAGAGAGCGTCAAAGCTCATCCCAGTTTTTCACCACTCCGGCAAAGTGCCCGGTTTTCGCGTCTGCGGGTGAGGATGAACGGAGGATAAATGGTGCCCAAACCGGACAGCGGCACCTTCCTTCTCCTTTTTTTGCTTGTACTTACACTGACTGAGCCGCTGCGGCCAGAGCTGCGCTGCACACCAGGGCAGTTTGCGTGCCACAGTGGTACCATACAGTGTATCCCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGTCAACTGTCCAGGTCTGGCTGGAGACCAGCGAACATTTCATGGAAAGGAGAGTGTGGACACACGTTTTAACAGAGGTCGGAATGGGGAAACCCCTCGATTTCATACAGTGAACTTTGCCCAGCCTGTCCGTTTCAGCAGTTTCCTAGGAAAATGTCCATCAGGATGGCATCATTATGAAGGAACAGCCAGCTGTTATAAGGTATACTCATCAGGAGAAAATTACTGGGATGCTGTACAAATATGTCAGAAGGTAAATGGGTCTCTGGCAACCTTCACTACAGACCAGGAGCTGAAATTCATTTTGGCCCAAGAAGTGGGACGTGGCGGAAAGACCATTTGGAAGGAAGGATCAGCTGAGATTGTGGGTTGGCTACCAGTTTGTTATTACCAGCAGGAACCATTCTATGGAGGGTCATTGGGAAGTACCATATAAAGGATCTGCTGAGGTTTTCCTTGCCCCCCGTGCCCATCTTTGGAACGCCCGACAATGAGAATATCTTGTGGCGCCCCGTT
  5   1   2       bld Emb4      out                   IMAGE:4202581.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAAAAAAGCTTTCGGGGACCGGNNCCGGNAAAACCCGCCNAATCGNCGACCCACGCGTCCGGNTTTCTCTCTTGCAGAGCTGCGCTGCACACCAGGGCAGTTTGCGTGCCACAGTGGTACCATACAGTGTATCCCCCTTCACTGGCAGTGTGATGGATGGCCAGCATGTGAAGATGAGAGTGATGAGGGCAACTGTCCAGGTTTGGCTGGAGACCAGCGAACATTTCATGGAAAGGAGAGTGGGGACACACGTTTTAACAGACGTCGGAATGGGGAAACCCCTCGATTTCATACAGTGAACTTTGCCCAGCCTGTCCGATACAGCAGTTTCCTAGGAAAATGTCCATCAGGATGGCATCATTATGAAGGAACAGCCAGCTGTTATAAGGTATACTCATCAGGAGAAAATTACTGGGATGCTGTACAAATATGTCAGAAGGTAAATGGGTCTCTGGCAACCTTCACTACAGACCAGGAGCTGAAATTCATTTTGGCCCAAGAGTGGGACGGGGCGGAAAGACCATTTGGAAGGAAGGATCAGCTGAGATTGTGGGTTGGCTACCAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)