Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL485a16ex.5                          8 END     1          20       12                (no blast hit)

 This cluster: approximate FL confidence score = 86%

 1012790064 Xl3.1-IMAGE:4032131.5 - 5 ESTs
                                                                       .......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4032131.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGTGAATGTAGAACAGTGCTGTTATTAGGCGGAGTTTAATGTCAGAGCGGTGCAACACTACACACAAGAAGATAAAATGTCATCCGTACTTTCAGAATATACAATTGGTGGGGTGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCCCAGCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTAGCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTATATGGAAAGCAGTTGGTGGATGAAAAATCAGATGAGAAAGAGTGGAAAAAAATGGAGAGAGTTACTCCATGCTGCTGTTCATGTCATTTGAAAAATTCTGATCAAACTACTTTCTCCAGTGATAGACAAATGAATTCTACAGATAACGCACCATCAAATATTTCCGGAGCTTCTAGTAACAAAACTACATTAGCTTCAAAGCTGTGTGCAAAGAAGCAAGCATCTTTTACAACAGATCAAGATGATGATTTTCAAACTGACAGGAAAAGGATTCGCCAGTCTCATGATGAACAACTGCAAGCAAGAAAACGTCGTTGTTATGAAAAAGGTGTG
                                                  Xl3.1-CHK-1012706094                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATGTAGAACAGTGCTGTTATTAGGCGGAGTTTAATGTCAGAGCGGTGCAACACTACACACAAGAAGATAAAATGTCATCCGTACTTTCAGAATATACAATTGGTGGGGTGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCCCAGCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTAGCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTATATGGAAAGCAGTTGGTGGATGAAAAATCAGATGAGAAAGAGTGGAAAAAAATGGAGAGAGTTACTCCATGCTGCTGTTCATGTCATTTGAAAAATTCTGATCAAACTACTTTCTCCAGTGATAGACAAATGAATTCTACAGATAACGCACCATCAAATATTTCCGGAGCTTCTAGTAACAAAACTACATTAGCTTCAAAGCTGTGTGCAAAGAAGCAAGCATCTTTTACAACAGATCAAGATGATGATTTTCAAACTGACAGGAAAAGGATTCGCCAGTCTCATGATGAACAACTGCAAGCAAGAAAACGTCGTTGTTATGAAAAAGGTGTGCAACCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   2     3     2     3     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      78      81                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN      33      47                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH OVR      78     229                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               ORF LNG      78       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 9e-007     NP_493618.1 Deletions Of G-rich DNA family member (dog-1) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ag ==== 6e-009     XP_311162.4 AGAP000634-PA [Anopheles gambiae str. PEST] ===========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Sp ==== 3e-009     XP_001197614.1 PREDICTED: similar to Rtel1 protein, partial [Strongylocentrotus purpuratus] ==========================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 3e-010     NP_572254.1 CG4078-PA [Drosophila melanogaster] ===============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Os ---- 7e-012     NP_001063870.1 Os09g0551800 [Oryza sativa (japonica cultivar-group)] ==================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- At ---- 1e-012     NP_178113.3 helicase-related [Arabidopsis thaliana] ----------------------------------------------------=============================================================================================================================================================================================
                                                                       PROTEIN --- ?? ---- 2e-017     XP_637574.1 DEAD/DEAH box helicase [Dictyostelium discoideum AX4] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Dr ==== 3e-043     NP_001103766.1 hypothetical protein LOC794038 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Gg ==== 2e-045     NP_001028230.1 BRCA1 interacting protein C-terminal helicase 1 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Cf ==== 4e-049     XP_852649.1 PREDICTED: similar to BRCA1 interacting protein C-terminal helicase 1 [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 4e-049     NP_840094.1 BRCA1 interacting protein C-terminal helicase 1 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 4e-049     NP_114432.1 BRCA1 interacting protein C-terminal helicase 1 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Xl ==== 1e-101     NP_001083272.1 hypothetical protein LOC398837 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4032131.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAG------------------------------------------------ATG------------------------------------------------------------------------------ATGATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       bld Oo1  5g                         IMAGE:5078429.5p                                                                                                                                                                                                                                                                                                                                                                                                                              CACACTTCCTGAACCCCTGTCTATGGAGCTGCTGCTGCGGCCCATCCACAGGAAAGAGCGGGAGTTGTGAATGTAGAACAGTGCTGTTATTAGGCGGAGTTTAATGTCAGAGCGGTGCAACACTACACACAAGAAGATAAAATGTCATCCGTACTTTCAGAATATACAATTGGTGGGGTGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCTCTTTCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTAGCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTATATGGAAAGCAGTTGGTGGATGAAAAATCAGATGAGAAAGAGTGGAAAAAAATGGAGAGAGTTACTCCATGCTGCTGTTCATGTCATTTGAAAAATTCTGATCAAACTACTTTCTCCAGTGATAGACAAATGAATTCTACAGATAACGCACCATCAAATATTTCCGGAGCTTCTAGTA
  5   1   2      seed Emb4 5g                         IMAGE:5571229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGAGCTGCTGCTGCGGCCCATCCACAGGAAAGAGCGGGAGTTGTGAATGTAGAACAGTGCTGTTATTAGGCGGAGTTTAATGTCAGAGCGGTGCAACACTACACACAAGAAGATAAAATGTCATCCGTACTTTCAGAATATACAATTGGTGGGGTGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCCCAGCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTAGCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTATATGGAAAGCAGTTGGTGGATGAAAAATCAGATGAGAAAGAGTGGAAAAAAATGGAGAGAGTTACTCCATGCTGCTGTTCATGTCATTTGAAAAATTCTGATCAAACTACTTTCTCCAGTGATAGACAAATGAATTCTACAGATAACGCACCATCAAATATTTCCGGAGCTTCTAGTAACAAAACTACATTAGCTTCAAAGCTGTGTGCAAAGAAGCAAGCATCTTTTACAACAGATCAAGATGATGATTTTCAAACTGACAGGAAAAGGATTCGCCAGTCTCATGATGAACAACTGCAAGCAAGAAAACGTCGTTGTTATGAAAAAGGTGTGCAACCTTATtgatgatgaagatgatgatgatCCGGAATCATGTGAAAGTTTGAATAGTTTACAATCAAAAAAGAACTAACCATGGATAATTTGTCCCAAAGGAACTAATTGCTTGCTTCTTCCCCATTATTCCGGTTGGGCCTTTGCCCAATTGAGCTTATTGGGGGGCCAACCCCCACAAAACCGCTATCGCCTCCGGAAAAGGTGCCGAAAAGGGATAGGGGGATAAAGTGCCCAAGGTGCCACCAAAAAAATTT
  5   1   2       bld Kid  5g                         IMAGE:4032131.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTTGTGAATGTAGAACAGTGCTGTTATTAGGCGGAGTTTAATGTCAGAGCGGTGCAACACTACACACAAGAAGATAAAATGTCATCCGTACTTTCAGAATATACAATTGGTGGGGTGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCCCAGCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTAGCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTATATGGAAAGCAGTTGGTGGATGAAAAATCAGATGAGAAAGAGTGGAAAAAAATGGAGAGAGTTACTCCATGCTGCTGTTCATGTCATTTGAAAAATTCTGATCAAACTACTTTCTCCAGTGATAGACAAATGAATTCTACAGATAACGCACCATCAAATATTTCCGGAGCTTCTAGTAACAAAACTACATTAGCTTCAAAGCTGTGTGCAAAGAAGCAAGCATCTTTTACAACAGATCAAGATGATGATTTTCAAACTGACAGGAAAAGGATTCGCCAGTCTCATGATGAACAACTGCAGGCAAGAAAACGTCGTTGTTATGAAAAAGGTGTGCAGTTTATtgatgatgatgatgatgatCGGGATCATGTGAAGTTTGATAGTTACAATCAAAGAAGAGCTAGCATGGATAGTTGTGCAGAGGAAGCTATTGCTGCTTCTTTCAATCATTCTGCTGGGCCTTGCAGTCTGTGTTTTTTGTGGTCAGACCAAAGGAAGAGGATAAAGCTACTGAAAAGTGCAAGAAGGAAAACGGAAGAGAAGCCAAAAGTGC
  5   1   2       bld Emb4 5g                         IMAGE:4957574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGTTATTAGGTTTGAGCTTAATGTCAGAGCGGTGCAACACTACACACAAGAAGATAAAATGTCATCCGTACTTTCAGAATATACAATTGGTGGGGTGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCCCAGCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTAGCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTATATGGAAAGCAGTTGGTGGATGAAAAATCAGATGAGAAAGAGTGGAAAAAAATGGAGAGAGTTACTCCATGCTGCTGTTCATGTCATTTGAAAAATTCTGATCAAACTACTTTCTCCAGTGATAGACAAATGAATTCTACAGATAACGCACCATCAAATATTTCCGGAGCTTCTAGTAACAAAACTAC
  5   1   2       bld Egg6      out                   IMAGE:4434964.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCCCAGCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTATCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)