Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.6699999999999999    0Xl3.1-xl313j02.5                            4 END     3         100       75                dicer 1, ribonuclease type III [Xenopus (Silurana) tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012790092 Xl3.1-xl313j02.3 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl313j02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAGAAATCAGGATAACTATGTGTCTTGGAGTGATTCTGAAGATGATGATGATGACGAAGATGAAGAAATTGAGGAGAAAGAAAAAACGGAAACAAGTTTTCCATCCCCATTCACAAACATTCTGTGTGGCATCATCTTCGTGGAACGTAGATACACAGCCGTAGTATTAAACAGGTTAATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGCAACTTTATTACAGGACACGGCATAGGAAAGAACCAGCCACGCAATAAGCAGATGGAAGTTGAGTTCAGAAAGCAGGAAGAGGTTCTTCGTAAATTTCGTGCACACGAAACCAACTTGTTGATAGCTACAAGCATTGTTGAGGAAGGAGTGGACATACCAAAATGCAACTTGGTGGTTCGATTTGATTTACCTTCAGAGTACAGATCCTATGTTCAATCCAAAGGCAGAGCCAGAGCACCAATCTCAAATTACATCATGCTAGCTGATAGTGATAAAATAAAGACATTTGAAGAGGACCTTAAAACATACAAAGCAATCGAAAAGATTTTGCGGAACAAATGCTCAAAATCCATTGATTGTGGAAATACGGAATCTGAGCCCGTTGTGGATGATGATGAAATATTTCCNCCTTACGTATTGAGACAGGATGATGGCAGCCCACGAGTTACAATCAACACAGCTATTGGACATATCAACAGGTCTTGCAAATGGAGAGCAATCTTTTTTTTTTAATTAAAGACATCATCTG
                                                  Xl3.1-CHK-1012712159                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCAGGATAACTATGTGTCTTGGAGTGATTCTGAAGATGATGATGATGACGAAGATGAAGAAATTGAGGAGAAAGAAAAAACGGAAACAAGTTTTCCATCCCCATTCACAAACATTCTGTGTGGCATCATCTTCGTGGAACGTAGATACACAGCCGTAGTATTAAACAGGTTAATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGCAACTTTATTACAGGACACGGCATAGGAAAGAACCAGCCACGCAATAAGCAGATGGAAGTTGAGTTCAGAAAGCAGGAAGAGGTTCTTCGTAAATTTCGTGCACACGAAACCAACTTGTTGATAGCTACAAGCATTGTTGAGGAAGGAGTGGACATACCAAAATGCAACTTGGTGGTTCGATTTGATTTACCTTCAGAGTACAGATCCTATGTTCAATCCAAAGGCAGAGCCAGAGCACCAATCTCAAATTACATCATGCTAGCTGATAGTGATAAAATAAAGACATTTGAAGAGGACCTTAAAACATACAAAGCAATCGAAAAGATTTTGCGGAACAAATGCTCAAAATCCATTGATTGTGGAAATACGGAATCTGAGCCCGTTGTGGATGATGATGAAATATTTCCNCCTTACGTATTGAGACAGGATGATGGCAGCCCACGAGTTACAATCAACACAGCTATTGGACATATCAACAGGTCTTGCAAATGGAGAGCAATCTTTTTTTTTTAATTAAAGACATCATCTGCCTAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     1     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                                                                   PROTEIN --- Xl ---- 5e-013     NP_001085915.1 MGC82787 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 5e-022     NP_498761.1 DiCer Related, LEThal LET-740 (dcr-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Os ---- 8e-024     NP_001048796.1 Os03g0121800 [Oryza sativa (japonica cultivar-group)] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-028     XP_312076.2 AGAP002836-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-029     NP_524453.1 Dicer-1 CG4792-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 9e-041     XP_001197815.1 PREDICTED: similar to Dicer protein [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 5e-119     NP_683750.2 dicer1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 2e-119     XP_683474.3 PREDICTED: Dicer1, Dcr-1 homolog [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 3e-122     NP_976235.1 Dicer1, Dcr-1 homolog [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-124     NP_803187.1 dicer1; helicase-moi; K12H4.8-LIKE; helicase with RNAse motif [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 7e-125     NP_001035555.1 dicer1 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 7e-125     XP_868526.1 PREDICTED: similar to dicer1 isoform 4 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 3e-132     NP_001123390.1 dicer 1, ribonuclease type III [Xenopus (Silurana) tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl313j02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  3   1   2       bld DMZ  5g3  out                        xl313j02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAGAAATCAGGATAACTATGTGTCTTGGAGTGATTCTGAAGATGATGATGATGACGAAGATGAAGAAATTGAGGAGAAAGAAAAAACGGAAACAAGTTTTCCATCCCCATTCACAAACATTCTGTGTGGCATCATCTTCGTGGAACGTAGATACACAGCCGTAGTATTAAACAGGTTAATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGCAACTTTATTACAGGACACGGCATAGGAAAGAACCAGCCACGCAATAAGCAGATGGAAGTTGAGTTCAGAAAGCAGGAAGAGGTTCTTCGTAAATTTCGTGCACACGAAACCAACTTGTTGATAGCTACAAGCATTGTTGAGGAAGGAGTGGACATACCAAAATGCAACTTGGTGGTTCGATTTGATTTACCTTCAGAGTACAGATCCTATGTTCAATCCAAAGGCAGAGCCAGAGCACCAATCTCAAATTACATCATGCTAGCTGATAGTGATAAAATAAAGACATTTGAAGAGGACCTTAAAACATACAAAGCAATCGAAAAGATTTTGCGGAACAAATGCTCAAAATCCATTGATTGTGGAAATACGGAATCTGAGCCCGTTGTGGATGATGATGAAATATTTCCNCCTTACGTATTGAGACAGGATGATGGCAGCCCNCGAGTTACAATCAACACAGCTATTGGACATATCAACAGGTCTTGCAAATGGAGAGCAATCTTTTTTTTTTAATTAAAGACATCATCTGCC
  3   1   1       add DMZ  5g3  out                        xl237g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGNAATTGAGGAGAANGAAAAAACGGAANCAAGTTTTCCATCNCCATTCACAAACATTNTGTGNGGCATCATCTTCGTGGAACGTAGATACACAGCNGTAGTATTAAACAGGTTAATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGCAACTTTATTACAGGNCNCGGCATNGGAAAGAACCAGCCNCGCAATANGCAGATGGAAGTTGAGTTCAGAAAGCAGGAAGNGGTTCTTCGTAAATTTCGTGCACACGAAACCAACTTGTTGANAGCTACAAGCATTGTTGAGGAAGGAGTGGACATACCAAAATGCAACTTGGTGGTTCGATTTGATTTACCTTCAGAGTACAGATCCTATGTTCAATCCAAAGGCAGAGCCAGAGCNCCAATCTCAAATTNCATCATGCTAGCTGATAGTGATAAAATAAAGACATTTGAAGAGGACCTTAAAACATACAAAGCAATCGAAAAGATTTTGCGGAACAAATGCTCAAAATCCNTTGATTGTGGAAATNCGGAATNTGAGCCCGTTGTGGATGATGATGAAATATTTCCNCCTTACGTATNGAGACAGGATGATGGCAGCCCACGAGTTACAATCAACACAGCTATTGGACATATCAACAGGTCTTGCAAATGGAGAGCAATCTTTTTTTTTTAATTAAAGACATCATCTGCCTAAAA
  3   1   2      seed DMZ  5g3  out                        xl277o04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCGTGGAACGTAGATACACAGCCGTAGTATTAAACAGGTTAATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGCAACTTTATTACAGGACACGGCATAGGAAAGAACCAGCCACGCAATAAGCAGATGGAAGTTGAGTTCAGAAAGCAGGAAGAGGTTCTTCGTAAATTTCGTGCACACGAAACCAACTTGTTGATAGCTACAAGCATTGTTGAGGAAGGAGTGGACATACCAAAATGCAACTTGGTGGTTCGATTTGATTTACCTTCAGAGTACAGATCCTATGTTCAATCCAAAGGCAGAGCCAGAGCACCAATCTCAAATTACATCATGCTAGCTGATAGTGATAAAATAAAGACATTTGAAGAGGACCTTAAAACATACAAAGCAATCGAAAAGATTTTGCGGAACAAATGCTCAAAATCCATTGATTGTGGAAATACGGAATCTGAGCCCGTTGTGGATGATGATGAAATATTTCCNCCTTACGTATTGAGACAGGATGATGGCAGCCCACGAGTTACAATCAACACAGCTATTGGACATATCAACAGGTCTTGCAAATGGAGAGCAATCTTTTTTTTTTAATTAAAGACATCATCTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)