Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4677899.3                       5 END     1          50       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7018838.5                      29 PI      77         67      640                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6956533.3                      17 PI      82        213      634                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:6631425.5                       2 PI      96          1      682                hippocalcin-like 1 [Gallus gallus]
     5   0.0    0Xl3.1-IMAGE:7981249.5                       2 PI      94          2      502                hippocalcin-like 1 [Gallus gallus]
     6   0.0    0Xl3.1-IMAGE:3301762-IMAGp.5                 2 PI      81         75      634                hippocalcin [Xenopus laevis]

 This cluster: approximate FL confidence score = 90%

 1012790253 Xl3.1-IMAGE:8547847.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8547847.5 CCCAGCTAACTGTATTACTACCAGACGTCTTGACCTGCATTGAATTTCGCCTTCAGTACTAAATAAGCATCAGAATGGGGAAACAGAACAGTAAGCTGCGGCCTGAGATCCTACAAGATCTCCGGGAAAACACAGAGTTCACAGACCACGAATTGCAGGAATGGTACAAAGGCTTCCTGAAGGATTGTCCCACTGGGCACTTAACAGTCGAAGAATTCAAAAAGATATACGCCAACTTCTTCCCGTACGGAGATGCCTCAAAGTTCGCGGAGCACGTGTTCCGTACATTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTTATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCATTTAGCATGTACGACCTGGATGGAAATGGCTATATCAGCCGCGGGGAGATGCTAGAAATTGTGCAGGCAATATACAAAATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCTACTCCAGAAAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGTGACCCTTCCATCGTCCGATTGCTACAGTGTGACCCGAGCAGCACCAGCCAGTTCTAACCCTCCCCCTCTCATACGGACAATGGCAACAGGCCACGTGGCTTGTGATTTAAGCTCTGCAAGTGGATGCCTTCTCCATCCTTCCTCTACTTGTAGCGGATCCCCACCCCCTCGCCAGAAAACAGCCTTGCCCCTCCCCCTTCATTTCCCACTCGCTGACATTCCTTTTCTCTGGCATCAGTCTCACTCACACTTATGTTTACATACAGATACAAGGGAACTGTTCTCCTGCTCAAGTCTCGCTGCCCTGGATTATTATATACGCGGAATATAACGGTGGTGCGACGACGCTACGCTGAACTCTTATTTGAATAGA
                                                  Xl3.1-CHK-1012716711       TAACTGTATTACTACCAGACGTCTTGACCTGCATTGAATTTCGCCTTCAGTACTAAATAAGCATCAGAATGGGGAAACAGAACAGTAAGCTGCGGCCTGAGATCCTACAAGATCTCCGGGAAAACACAGAGTTCACAGACCACGAATTGCAGGAATGGTACAAAGGCTTCCTGAAGGATTGTCCCACTGGGCACTTAACAGTCGAAGAATTCAAAAAGATATACGCCAACTTCTTCCCGTACGGAGATGCCTCAAAGTTCGCGGAGCACGTGTTCCGTACATTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTTATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCATTTAGCATGTACGACCTGGATGGAAATGGCTATATCAGCCGCGGGGAGATGCTAGAAATTGTGCAGGCAATATACAAAATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCTACTCCAGAAAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGTGACCCTTCCATCGTCCGATTGCTACAGTGTGACCCGAGCAGCACCAGCCAGTTCTAACCCTCCCCCTCTCATACGGACAATGGCAACAGGCCACGTGGCTTGTGATTTAAGCTCTGCAAGTGGATGCCTTCTCCATCCTTCCTCTACTTGTAGCGGATCCCCACCCCCTCGCCAGAAAACAGCCTTGCCCCTCCCCCTTCATTTCCCACTCGCTGACATTCCTTTTCTCTGGCATCAGTCTCACTCACACTTATGTTTACATACAGATACAAGGGAACTGTTCTCCTGCTCAAGTCTCGCTGCCCTGGATTATTATATACGCGGAATATAACGGTGGTGCGACGACGCTACGCTGAACTCTTATTTGAATAGAATAAGC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     109     224 
                                               BLH MIN     109     136 
                                               BLH OVR     109     259 
                                               ORF LNG     109       6 
  5   1   2      seed Thy  5x3                        IMAGE:8547847.5p CCCAGCTAACTGTATTACTACCAGACGTCTTGACCTGCATTGAATTTCGCCTTCAGTACTAAATAAGCATCAGAATGGGGAAACAGAACAGTAAGCTGCGGCCTGAGATCCTACAAGATCTCCGGGAAAACACAGAGTTCACAGACCACGAATTGCAGGAATGGTACAAAGGCTTCCTGAAGGATTGTCCCACTGGGCACTTAACAGTCGAAGAATTCAAAAAGATATACGCCAACTTCTTCCCGTACGGAGATGCCTCAAAGTTCGCGGAGCACGTGTTCCGTACATTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTTATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCATTTAGCATGTACGACCTGGATGGAAATGGCTATATCAGCCGCGGGGAGATGCTAGAAATTGTGCAGGCAATATACAAAATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCTACTCCAGAAAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGTGACCCTTCCATCGTCCGATTGCTACAGTGTGACCCGAGCAGCACCAGCCAGTTCTAACCCTCCCCCTCTCATACGGACAATGGCAACAGGCCACGTGGCTTGTGATTTAAGCTCTGCAAGTGGATGCCTTCTCCATCCTTCCTCTACTTGTAGCGGATCCCAACCC
  5   1   2       bld Emb4      out                   IMAGE:5440127.5p                                                                                                                                                                                                                                                                                                              GGGATGGGACATCCATTTCCGGGAATTTATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCATTTAGCATGTACGACCTGGATGGAAAGGGCTATATCAGCCGCGGGGAGATGCTAGAAATTGTGCAGGCAATATACAAAATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCTACTCCAGAAAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGTGACCCTTCCATCGTCCGATTGCTACAGTGTGACCCGAGCAGCACCAGCCAGTTCTAACCCTCCCCCTCTCATACGGACAATGGCAACAGGCCACGTGGCTTGTGATTTAAGCTCTGCAAGTGGATGCCTTCTCCATCCTTCCTCTACTTGTAGCGGATCCCCACCCCCTCGCCAGAAAACAGCCTTGCCCCTCCCCCTTCATTTCCCACTCGCTGACATTCCTTTTCTCTGGCATCAGTCTCACTCACACTTATGTTTACATACAGATACAAGGGAACTGTTCTCCTGCTCAAGTCTCGCTGCCCTGGATTATTATATACGCGGAATATAACGGTGGTGCGACGACGCTACGCTGAACTCTTATTTGAATAGAATAAGCAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)