Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL077a12.3.5                         12 END     2          40       16                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012790646 Xl3.1-XL103i21.5 - 5 ESTs
                                                                       -70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL103i21.5                                                                       GCGGCCTTTACAAACCTGTGCAGTGCCACCAGTCCACTGGATATTGTTGGTGTGTCTTAGTAGACACTGGTCGTCCATTGCCTGGAACATCTACACGTTATGAAACTCCTGTGTGCGAAAGTGATGCCAGATGGAAAAATACGGACGCTGAAGACCCATTTAAAGACAGAGAATTAGCAGGTTGTCCAGAAGGAAAGAAGCTGGAATTCATCACCAGTTTATTGGACGCTCTCACCACGGACATGGTGCAAGCCATCAACTCAGCAGCGCCGGCCGCAGGCGGGAGATTCTCAGAGCCAGATCCCAATCACACACTGGAGGAAAGAGTGGTCCTTTGGTACTTCAGCCAGTTAGACAGCAACGCCAGTGAGGACATAAATAAGAAGGAGATGAAGCCCTTCAAAAGATACGTAAAAAAGAAAGCCAAACCCAAGAAATGTGCCCGGCGTTTCACTGACTACTGTGATCTTAATAAGGACAAATCCATTTCATTTCCAGAGCTTAAAGGCTGTCTAGGAGTCCGCAAGGAACCAGGTGCAAATGCTGGAAGTTTCCCTCCTGGAAAGCGGCCCGGCTCTAACCCCTTCAGTCGCCTTGCGTAGGAGAGCCGGCCAGAAGAAGGAGACAGAGAGAAGAGAGGGATGCTGTGGGCGCAGTTGCCGGAGCCACCGATGGGTCGCACAATGTTTGCACTTTTGAGTGAACTTT
                                                  Xl3.1-CHK-1012704447                                                                             TTTACAAACCTGTGCAGTGCCACCAGTCCACTGGATATTGTTGGTGTGTCTTAGTAGACACTGGTCGTCCATTGCCTGGAACATCTACACGTTATGAAACTCCTGTGTGCGAAAGTGATGCCAGATGGAAAAATACGGACGCTGAAGACCCATTTAAAGACAGAGAATTAGCAGGTTGTCCAGAAGGAAAGAAGCTGGAATTCATCACCAGTTTATTGGACGCTCTCACCACGGACATGGTGCAAGCCATCAACTCAGCAGCGCCGGCCGCAGGCGGGAGATTCTCAGAGCCAGATCCCAATCACACACTGGAGGAAAGAGTGGTCCTTTGGTACTTCAGCCAGTTAGACAGCAACGCCAGTGAGGACATAAATAAGAAGGAGATGAAGCCCTTCAAAAGATACGTAAAAAAGAAAGCCAAACCCAAGAAATGTGCCCGGCGTTTCACTGACTACTGTGATCTTAATAAGGACAAATCCATTTCATTTCCAGAGCTTAAAGGCTGTCTAGGAGTCCGCAAGGAACCAGGTGCAAATGCTGGAAGTTTCCCTCCTGGAAAGCGGCCCGGCTCTAACCCCTTCAGTCGCCTTGCGTAGGAGAGCCGGCCAGAAGAAGGAGACAGAGAGAAGAGAGGGATGCTGTGGGCGCAGTTGCxGxxxCCACCGATGGGTCGCACAATGTTTGCACTTTTGAGTGAACTTTATTCAT
                                                      consensus depths                                                                            2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     1     4     2     2     2     2     2     2
  5   1   2       bld FaB       out                   IMAGE:8071095.5p GCGACAAAGTGCTCTGGAGGAAGCAAACTGAACCCGAGAGAGGGAATTGTGATTCCAGAATGTGCCCCAGGCGGCCTTTACAAACCTGTGCAGTGCCACCAGTCCACTGGATATTGTTGGTGTGTCTTAGTAGACACTGGTCGTCCATTGCCTGGAACATCTACACGTTATGAAACTCCTGTGTGCGAAAGTGATGCCAGATGGAAAAATACGGACGCTGAAGACCCATTTAAAGACAGAGAATTAGCAGGTTGTCCAGAAGGAAAGAAGCTGGAATTCATCACCAGTTTATTGGACGCTCTCACCACGGACATGGTGCAAGCCATCAACTCAGCAGCGCCGGCCGCAGGCGGGAGATTCTCAGAGCCAGATCCCAATCACACACTGGAGGAAAGAGTGGTCCTTTGGTACTTCAGCCAGTTAGACAGCAACGCCAGTGAGGACATAAATAAGAAGGAGATGAAGCCCTTCAAAAGATACGTAAAAAAGAAAGCCAAACCCAAGAAATGTGCCCGGCGTTTCACTGACTACTGTGATCTTAATAAGGACAAATCCATTTCATTTCCAGAGCTTAAAGGCTGTCTAGGAGTCCGCAAGGAACCAGGTGCNAATGCTGGAAGTTTCCTCCTGGAAGCGGCCGGCTCTACCCCTTCATCGCCTGCGTAGAGAGCCGGCCAAAGAAGAACAGANAGAGAGAGCTGCTGTGGCGCAGTGCATGCTCGATGATCCACATGTTGCACTTGATGACTTA
  5   1   2      seed Tbd7      out                        XL103i21.5p                                                                       GCGGCCTTTACAAACCTGTGCAGTGCCACCAGTCCACTGGATATTGTTGGTGTGTCTTAGTAGACACTGGTCGTCCATTGCCTGGAACATCTACACGTTATGAAACTCCTGTGTGCGAAAGTGATGCCAGATGGAAAAATACGGACGCTGAAGACCCATTTAAAGACAGAGAATTAGCAGGTTGTCCAGAAGGAAAGAAGCTGGAATTCATCACCAGTTTATTGGACGCTCTCACCACGGACATGGTGCAAGCCATCAACTCAGCAGCGCCGGCCGCAGGCGGGAGATTCTCAGAGCCAGATCCCAATCACACACTGGAGGAAAGAGTGGTCCTTTGGTACTTCAGCCAGTTAGACAGCAACGCCAGTGAGGACATAAACAAGAAGGAGATGAAGCCCTTCAAAAGATACGTAAAAAAGAAAGCCAAACCCAAGAAATGTGCCCGGCGTTTCACTGACTACTGTGATCTTAATAAGGACAAATCCATTTCATTTCCAGAGCTTAAAGGCTGTCTAGGAGTCCGCAAGGAACCAGGTGCAAATGCTGGAAGTTTCCCTCCTGGAAAGCGGCCCGGCTCTAACCCCTTCAGTCGCCTTGCGTAGgagagccggccagaagaaggagacagagagaagagagGCATGCTGTGGGCGCAGTTGCAGTGCCTNCGATGGATCT
  5   1   2       bld Emb3                   IMAGE:3399690-IMAGp.IMAGp                                                                                                                                    AGACACTGGTCGTCCATTGCCTGGAACATCTACACGTTATGAAACTCCTGTGTGCGAAAGTGATGCCAGATGGAAAAATACGGACGCTGAAGACCCATTTAAAGACAGAGAATTAGCAGGTTGTCCAGAAGGAAAGAAGCTGGAATTCATCACCAGTTTATTGGACGCTCTCACCACGGACATGGTGCAAGCCATCAACTCAGCAGCGCCGGCCGCAGGCGGGAGATTCTCAGAGCCAGATCCCAATCACACACTGGAGGAAAGAGTGGTCCTTTGGTACTTCAGCCAGTTAGACAGCAACGCCAGTGAGGACATAAATAAGAAGGAGATGAAGCCCTTCAAAAGATACGTAAAAAAGAAAGCCAAACCCAAGAAATGTGCCCGGCGTTTCACTGACTACTGTGATCTTAATAAGGACAAATCCATTTCATTTCCAGAGCTTAAAGGCTGTCTAGGAGTCCGCAAGGAACCAGGTGCAAATGCTGGAAGTTTCCCTCCTGGAAAGCGGCCCGGCTCTAACCCCTTCAGTCGCCTTGCGTAGGAGAGCCGGCcagaagaaggagacagagagaagagagGGATGCTGTGGGCGCAGTTGCAGTGCCTCCCGATGGATCTCACAATGTTTGCACTTTTGAGTGAACTTTATTCATAAGGCttttttttgttttgtttCTTTATGTTCCATTATCTGAATGGAAATGAGAAGAAAATGTTGCTTCttttttttttt
  5   1   2       bld Emb3                   IMAGE:3399641-IMAGp.IMAGp                                                                                                                                                                           TGAAACTCCTGTGTGCGAAAGTGATGCCAGATGGAAAAATACGGACGCTGAAGACCCCTTTAAAGACAGAGAATTAGCAGGTTGTCCAGAAGGAAAGAAGCTGGAATTCATCACCAGTTTATTGGACGCTCTCACCACGGACATGGTGCAAGCCATCAACTCAGCAGCGCCGGCCGCAGGCGGGAGA
  5   1   1       add Brn3                            IMAGE:8539686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCAAGGAACCAGGTACAAATTTCCCTCTTGGAAAGAGGCCCGGCTCTAACCCCTTCAGTCGCCTTATGTAGGAGAGTCGGGGAGAAGCAGTCGCACACGATACCAAGGAGACGAGAGAGAAGAGCGGAATGATCTGGGCGCAGTCGCGGAGCCACCGATGGGTCGCACAATGTTTGCACTTTTGAGTGAACTTTATTCATAAGGtttttttttATGTTCCATTATCTGAATGGAAATGAGAAGAAAATGTTGCttttttgtttttttaagatggtttttataaaaaaaaaTCTGCTACTGACAAATAGGAATTGAACTTGTGACTGAGGGGAAATGGAGTGTCTGTATATAAATGTATATGTGAATTGTACAGTCCCTTTGTACAGGATTTCAGTGACTTATAGATCACAACCCATTCtttttttttttGCTGCTTTGCCTCCTAATGAAATGTCACTAATGTATTTGTATCTGTTCCTTTCATGTGGGTTTTATTAAAGGGGAACTCCGACTTCCAAACCAAAATATAATAAAGAGGCCACATAACACACAAACCCCTAATATACCCATCAGAGTTACCTGTTTCTACAAAAAGTCTGAATAAAAGCCATTTTCTATGCTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)