Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8547315.5                      10 END     1          50       10                hypothetical protein LOC495110 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7206428.5                      10 PI      94         73     1215                hypothetical protein LOC779843 [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:6643932.5                       4 PI      97        744     1241                hypothetical protein LOC779843 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 43%

 1012790758 Xl3.1-IMAGE:5083711.5 - 2 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     246      68                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     189     117                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Dm ---- 1e-012     NP_727843.1 HDAC6 CG6170-PC, isoform C [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 6e-013     NP_001122780.1 F41H10.6c [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- At ---- 2e-013     NP_001031419.1 zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 2e-018     XP_647029.1 UBP-type Zn finger-containing protein [Dictyostelium discoideum AX4] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 8e-050     XP_001193512.1 PREDICTED: similar to MGC83063 protein [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 7e-053     NP_001041464.1 zinc finger protein 3 [Ciona intestinalis] -------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Mm ==== 2e-083     XP_001480112.1 PREDICTED: hypothetical protein [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Cf ==== 7e-099     XP_532654.1 PREDICTED: similar to ubiquitin specific protease 44 [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 8e-103     NP_001035862.1 ubiquitin specific protease 44 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Bt ==== 6e-103     XP_595186.2 PREDICTED: similar to ubiquitin specific protease 44 isoform 1 [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 1e-105     NP_956551.1 hypothetical protein MGC55661 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 5e-123     XP_416154.2 PREDICTED: hypothetical protein [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Xt ==== 2e-154     NP_001072389.1 hypothetical protein LOC779843 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Xl ==== 4e-164     NP_001088277.1 hypothetical protein LOC495110 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5083711.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGA------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------TAG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------TAA---------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2      seed Ov1  5g3  out                   IMAGE:5073356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGCCCCCTTCCTTTCTGCCAGGCAGTCTCCTGACGTCATCATCGTCGTCACCGTGTACTGAGCGAGAGAGCTGAGCGGCGGGCAGAGTGAAAAGCCTGGACTTTGTTGTTATTGTTGTCTCTGCACCGCTTCTCCCTGGCCGGGAAGCGAGCGACAAGTCTGAGCGGCCAGTATGTATGTTCAAAATGCAACAGATCAACTGCAGCTTAGTTGACACCTGAATCTGAAAAACTGAAAATGGATAAATGTAAACACGTTGGCCGATTGCGTCTTGCCCAAGATCATTCGATTTTGAACCCTCAGAAGTGGCACTGTGTGGATTGCAACACTACAGAATCAGTGTGGGCTTGCCTAAGCTGTTCACATGTTGCATGTGGTCGATACATTGAAGAGCATGCACTGCGTCACTTTCAGGACAGTAAGCATCCCTTGGCTTTGGAGGTTAATGAACTTTATGTGTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCGATCAAAAGTCAGAATTACGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAAGTGCAGATGATTCATTCATTT
  5   1   2       bld Oo1                             IMAGE:5083711.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACTTTATGTGTTTTGTTACCTCTGTGATGATTATGTTCTCAATGACAACACCACTGGTGACCTTAAACTTTTACGAAGCACATTAAGTGCTATCAAAAGTCAGAATTACGACTGTACAACACGTAGTGGTCGGACTTTGCGGTCTATGGTAAGTGCAGATGATTCATTCATTTCACATGAAGGCGCACAAGCCTTTCTTCAGAATGAAGACCGAGCATTCACTGCATTGTGGCATCGGAGGCATGCTCTCTTAGGGAAGGTTTTTAGATCATGGTTTGCTTTGACTCCAAAAGGCAAGCAGAGGTTAGAAGAGGAACGCTTGAGGGAAGAGGCCGAGCAGAAGAGGGAGGAAGCAAGAAAAAGGCGGCAGCAATTGAAGCACAAATTAAAAGAAGAAATGGAAAGCACTCCCCCCAGAAAGAGTTCACGTTTGCAACAGCAAATACAGCCTTCACCCAAAATTGAATCGTCCTCTGTGCaaaaaatgaaccaaaaaaacgctccttccacaaaacaaaaTCCACCAGCACCTACCTCTGATAAAGCACGCTTAAAGAAAATTGGTAATTCTCCAATAAAAAGAAAGCCCACTGTGACCCCTGGAGTAACAGGGACTGAGGAATCTGGGGAACACTTGCTATATGAACTCAATACTTCAAATACTGAGTCATTTGCATGTTTTTCCGGGAGTGTTTTTTACCACTTNGATCTCAATCAAACTCAGGAGTTGTTTGGCAGCTTGATGGCAGTGGAAAAAACAAAGCCTGTCCCAGCAAAATACCCCACCCTGGGTGGCTGGAGCTACCCAAGGAGTTAACCACCCAAAAGCCACCACCTAAAAGGGTCCAAAAGGATCTAACTGGGGCAAAAGGCC

In case of problems mail me! (