Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012790777 Xl3.1-IMAGE:3750699-IMAGp.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3750699-IMAGp.5 ACGAGGGGAAGGCGACGTTTTTACAATGTTGAGGTCAACGTTACTGTTGACTGGAGAGCAGCCATTGTGAGGTCGGCCATGCCTTCATTCCCTCCACTGTGCAGAGCTACTGCCTGATCACCACAGATCTTCAGGAATGATAGGATGGGAAACAGCTGGTTGACCTCTCCTCGGTCACTAGCATTGGTCAAGACAGAACCTTCTTTTGGATGTAGTACGTCTTCAACTGCCAGATCTTTACGTGACCTCATTGTGCCAGGCTTTGATGTCATGAAGAAAAATGCTGTCCTGTGACAATAAGGTGCCTACGTTAGCTATTGAAAGCCAATCCCTTATAGAGGATGCTGGGACTTGTAGTTTGAAACCAGATTACAAGTTGGACTTCCCTGCTAAAGTGCAATTTTTTTAAGGAAGGCAACCACTAAACACTGGAGATTTATAATTTGCGATTTTATGTAGTGGTGCCTTGGGGGAAACACAGACATGGGCTGCATTAATACCTATGCACTAGCACACGTCAACCAATCAGGTTTGCTTTCTTTAGCGTAAGTGCACTAGATAAACCTAAAACTATTTCTGATTGGTTGCTGTGGGTTTGTGTAGAGGTTTATTATTGCTCTTATGTTGGTGAGTTCCTTAATTTTTCCCTTGCCTGCCTAGCCTTATTGTTTCATTAAGCCACTTCTAACTAGTTGTTCTTCATAAAGAAAATGAAAGTGAGGTTAATTAAGGGGCCATGTCTTTTTTATGTATGCAGAGTCCAGTATAAAAAAATTTAAAGAATAAAAAAAA
                                                  Xl3.1-CHK-1012708399       GGAAGGCGACGTTTTTACAATGTTGAGGTCAACGTTACTGTTGACTGGAGAGCAGCCATTGTGAGGTCGGCCATGCCTTCATTCCCTCCACTGTGCAGAGCTACTGCCTGATCACCACAGATCTTCAGGAATGATAGGATGGGAAACAGCTGGTTGACCTCTCCTCGGTCACTAGCATTGGTCAAGACAGAACCTTCTTTTGGATGTAGTACGTCTTCAACTGCCAGATCTTTACGTGACCTCATTGTGCCAGGCTTTGATGTCATGAAGAAAAATGCTGTCCTGTGACAATAAGGTGCCTACGTTAGCTATTGAAAGCCAATCCCTTATAGAGGATGCTGGGACTTGTAGTTTGAAACCAGATTACAAGTTGGACTTCCCTGCTAAAGTGCAATTTTTTTAAGGAAGGCAACCACTAAACACTGGAGATTTATAATTTGCGATTTTATGTAGTGGTGCCTTGGGGGAAACACAGACATGGGCTGCATTAATACCTATGCACTAGCACACGTCAACCAATCAGGTTTGCTTTCTTTAGCGTAAGTGCACTAGATAAACCTAAAACTATTTCTGATTGGTTGCTGTGGGTTTGTGTAGAGGTTTATTATTGCTCTTATGTTGGTGAGTTCCTTAATTTTTCCCTTGCCTGCCTAGCCTTATTGTTTCATTAAGCCACTTCTAACTAGTTGTTCTTCATAAAGAAAATGAAAGTGAGGTTAATTAAGGGGCCATGTCTTTTTTATGTATGCAGAGTCCAGTATAAAAAAATTTAAAGAATAAAAAAAAAAAAAA
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     1     1
                                           Xl3.1-IMAGE:3750699-IMAGp.5                                                                               ATG---------------------------------TGA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------TGA---TAA------------------TGA---------------------------------TAG---------------------------------TAA------------------------------------------------------------ATGTAG------------------------ATG------------------------------------------------------------TAA------TAG------------------------------------------TAG------------------ATG---------------------------------TAG------------------------------------------TAA------TGA---TGA---TAA---------------------ATG---------------------------------TAA
  5   1   2       bld Neu7                                 XL024e15.5p ACGAGGGGAAGGCGACGTTTTTACAATGTTGAGGTCAACGTTACTGTTGACTGGAGAGCAGCCATTGTGAGGTCGGCCATGCCTTCATTCCCTCCACTGTGCAGAGCTACTGCCTGATCACCACAGATCTTCAGGAATGATAGGATGGGAAACAGCTGGTTGACCTCTCCTCGGTCACTAGCATTGGTCAAGACAGAACCTTCTTTTGGATGTAGTACGTCTTCAACTGCCAGATCTTTACGTGACCTCATTGTGCCAGGCTTTGATGTCATGAAGAAAAATGCTGTCCTGTGACAATAAGGTGCCTACGTTAGCTATTGAAAGCCAATCCCTTATAGAGGATGCTGGGACTTGTAGTTTGAAACCAGATTACAAGTTGGACTTCCCTGCTAAAGTGCAATTTTTTTAAGGAAGGCAACCACTAAACACTGGAGATTTATAATTTGCGATTTTACGTAGTGGTGCCTTGGGGGAAACACAGACATGGGCTGCATTAATACCTATGCACTAGCACACGTCAACCAATCAGGTTTGCTTTCTTTAGCGTAAGTGCACTAGACAGACCTAAAACTATTTCTGATT
  5   1   2      seed Gas7                   IMAGE:3750699-IMAGp.IMAGp                                                                                                                                                                                                                                                                  CGGCTTTGATGTCATGAAGAAAAATGCTGTCCTGTGACAATAAGGTGCCTACGTTAGCTATTGAAAGCCAATCCCTTATAGAGGATGCTGGGACTTGTAGTTTGAAACCAGATTACAAGTTGGACTTCCCTGCTAAAGTGCAATTTTTTTAAGGAAGGCAACCACTAAACACTGGAGATTTATAATTTGCGATTTTATGTAGTGGTGCCTTGGGGGAAACACAGACATGGGCTGCATTAATACCTATGCACTAGCACACGTCAACCAATCAGGTTTGCTTTCTTTAGCGTAAGTGCACTAGATAAACCTAAAACTATTTCTGATTGGTTGCTGTGGGTTTGTGTAGAGGTTTATTATTGCTCTTATGTTGGTGAGTTCCTTAATTTTTCCCTTGCCTGCCTAGCCTTATTGTTTCATTAAGCCACTTCTAACTAGTTGTTCTTCATAAAGAAAATGAAAGTGAGGTTAATTAAGGGGCCATGTCTTTTTTATGTATGCAGAGTCCAGTATaaaaaaatttaaagaataaaaaaaaaaaaaaa
  5   1   2       bld Gas5      in                    IMAGE:3750699.5p                                                                                                                                                                                                                                                                                 GAAGAAAAATGCTGTCCTGTGACAATAAGGTGCCTACGTTAGCTATTGAAAGCCAATCCCTTATAGAGGATGCTGGGACTTGTAGTTTGAAACCAGATTACAAGTTGGACTTCCCTGCTAAAGTGCAATTTTTTTAAGGAAGGCAACCACTAAACACTGGAGATTTATAATTTGCGATTTTATGTAGTGGTGCCTTGGGGGAAACACAGACATGGGCTGCATTAATACCTATGCACTAGCACACGTCAACCAATCAGGTTTGCTTTCTTTAGCGTAAGTGCACTAGATAGACCTAAAACTATTTCTGATTGGTTGCTGTGGGTTTGTGTAGAGGTTTATTATTGCTCTTATGTTGGTGAGTTCCTTAATTTTTCCCTTGCCTGCCTAGCCTTATTGTTTCATTAAGCCACTTCTAACTAGTTGTTCTTCATAAAGAAAATGAAAGTGAGGTTAATTAA
  3   1   2       bld Gas5      in                    IMAGE:3750699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTATTTCTGATTGGTTGCTGTGGGTTTGTGTAGAGGTTTATTATTGCTCTTATGTTGGTGAGTTCCTTAATTTTTCCCTTGCCTGCCTAGCCTTATTGTTTCATTAAGCCACTTCTAACTAGTTGTTCTTCATAAAGAAAATGAAAGTGAGGTTAATTAAGGGGCCATGTCTTTTTTATGTATGCAGAGTCCAGTATAAAAAAATTTAAAGAATAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)