Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL438n22ex.3                          6 PI      93         14      686                similar to paired box gene 6 [Xenopus laevis]

 This cluster: approximate FL confidence score = 57%

 1012790819 Xl3.1-IMAGE:7980037.5 - 2 ESTs
                                                                       ..-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7980037.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATGCTCCATTTGCAGTCCTAGGGGAAAATCACTAGGCGTTGATCAGCAGATGTTGGGAATTACACAGTCCCTGGGAGGAGAAGCAGAAAAGATATTCAGAATTCCATCCATAAACCACGTGGGACCCGGCAGCGACTCAGACATGCAGAACAGTCACAGCGGTGTAAATCAACTCGGGGGAGTGTTTGTCAACGGCCGACCCCTGCCAGATTCGACCCGACAGAAGATTGTGGAATTAGCGCACAGCGGCGCGCGACCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGCGTGAGTAAGATCTTGGGCAGATATTACGAGACCGGATCGATCCGACCTCGGGCGATCGGTGGCAGCAAACCCAGAGTTGCCACCCCAGAAGTGGTGAACAAGATTGCCCACTATAAGCGAGAGTGCCCTTCTATCTTTGCCTGGGAAATCCGAGACAGGTTGCTGTCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGATAAGCAACAGATGGGATCGGAAGGGATGTATGACAAGCTCAGGATGCTCAATGGACAAACTGCAACTTGGGGGTCGCGGCCAGGGTGGTACCCGGGCACCTCAGTACCTGGCCACCAGCACAGGAGGGGTGTCACCACAAGAAGAGTAGGAAAAACACAACTCAATCACTCAATGGGAAACTCGACAGGCCAAATGAGCTTCACTGAAAGAATTACAAGAACAACTCCTTTCCCGGACAATAAGCCTAAAAGATTTGACACCTTTCCGAGTTTCCGGAAATGGGCA
                                                  Xl3.1-CHK-1012716538                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCATTTGCAGTCCTAGGGGAAAATCACTAGGCGTTGATCAGCAGATGTTGGGAATTACACAGTCCCTGGGAGGAGAAGCAGAAAAGATATTCAGAATTCCATCCATAAACCACGTGGGACCCGGCAGCGACTCAGACATGCAGAACAGTCACAGCGGTGTAAATCAACTCGGGGGAGTGTTTGTCAACGGCCGACCCCTGCCAGATTCGACCCGACAGAAGATTGTGGAATTAGCGCACAGCGGCGCGCGACCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGCGTGAGTAAGATCTTGGGCAGATATTACGAGACCGGATCGATCCGACCTCGGGCGATCGGTGGCAGCAAACCCAGAGTTGCCACCCCAGAAGTGGTGAACAAGATTGCCCACTATAAGCGAGAGTGCCCTTCTATCTTTGCCTGGGAAATCCGAGACAGGTTGCTGTCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGATAAGCAACAGATGGGATCGGAAGGGATGTATGACAAGCTCAGGATGCTCAATGGACAAACTGCAACTTGGGGGTCGCGGCCAGGGTGGTACCCGGGCACCTCAGTACCTGGCCACCAGCACAGGAGGGGTGTCACCACAAGAAGAGTAGGAAAAACACAACTCAATCACTCAATGGGAAACTCGACAGGCCAAATGAGCTTCACTGAAAGAATTACAAGAACAACTCCTTTCCCGGACAATAAGCCTAAAAGATTTGACACCTTTCCGAGTTTCCGGAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      51      97                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      51     110                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ==== 4e-048     XP_001183514.1 PREDICTED: similar to paired box protein Pax-2 alpha isoform [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Ag ==== 9e-052     XP_311087.4 AGAP000067-PA [Anopheles gambiae str. PEST] ==========================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 2e-053     XP_618574.4 PREDICTED: similar to Paired box protein Pax-5 (B-cell-specific transcription factor) (BSAP) isoform 1 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ==== 2e-059     NP_001024570.1 Variable ABnormal morphology family member (vab-3) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 9e-066     NP_001027641.1 Pax6 protein [Ciona intestinalis] ================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 3e-073     NP_524638.3 CG11186-PA [Drosophila melanogaster] -------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Cf ==== 6e-091     NP_001091013.1 paired box gene 6 [Canis lupus familiaris] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 5e-091     NP_038655.1 paired box gene 6; small eye; Dickie's small eye [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 9e-092     NP_990397.1 PAX6 protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 6e-094     NP_001121084.1 paired box gene 6 isoform a [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Bt ==== 5e-094     NP_001035735.1 paired box gene 6 [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 3e-094     NP_571716.1 paired box gene 6b [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 7e-116     AAB36681.1 paired-type homeodomain Pax-6 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7980037.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2      seed Em10 5g                         IMAGE:7980037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATGCTCCATTTGCAGTCCTAGGGGAAAATCACTAGGCGTTGATCAGCAGATGTTGGGAATTACACAGTCCCTGGGAGGAGAAGCAGAAAAGATATTCAGAATTCCATCCATAAACCACGTGGGACCCGGCAGCGACTCAGACATGCAGAACAGTCACAGCGGTGTAAATCAACTCGGGGGAGTGTTTGTCAACGGCCGACCCCTGCCAGATTCGACCCGACAGAAGATTGTGGAATTAGCGCACAGCGGCGCGCGACCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGCGTGAGTAAGATCTTGGGCAGATATTACGAGACCGGATCGATCCGACCTCGGGCGATCGGTGGCAGCAAACCCAGAGTTGCCACCCCAGAAGTGGTGAACAAGATTGCCCACTATAAGCGAGAGTGCCCTTCTATCTTTGCCTGGGAAATCCGAGACAGGTTGCTGTCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCGAGCGATAAGCAACAGATGGGATCGGAAGGGATGTATGACAAGCTCAGGATGCTCAATGGACAAACTGCAACTTGGGGGTCGCGGCCAGGGTGGTACCCGGGCACCTCAGTACCTGGCCACCAGCACAGGAGGGGTGTCACCACAAGAAGAGTAGGAAAAACACAACTCAATCACTCAATGGGAAACTCGACAGGCCAAATGAGCTTCACTGAAAGAATTACAAGAACAACTCCTTTCCCGGACAATAAGCCTAAAAGATTTGACACCTTTCCGAGTTTCCGGAAATGGGCAATCA
  5   1   2       bld DMZ                                  xl264e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTCCTCCATTTCTGTGATACAGTCATGCTGTGAGAGCACACTGTCGCCATCTTGTGAGGGGCCCCAGCGTCTTTTTTCCGTTTACTATCTGGGCTGGACACGTCAGGAACACTTTGTTTTAACTTTTTCTTCGGCTTTGGTCACAGCGGTGTAAATCAACTCGGGGGAGTGTTTGTCAACGGCCGACCCCTGCCAGATTCGACCCGACAGAAGATTGTGGAATTAGCGCACAGCGGCGCGCGACCCTGCGACATTTCTCGGATTCTGCAGGTGTCCAACGGCTGCGTGAGTAAGATCTTGGGCAGATATTACGAGACCGGATCGATCCGACCTCGGGCGATCGGTGGCAGCAAACCCAGAGTTGCCACCCCAGAAGTGGTGAACAAGATTGCCCACTATAAGCGAGAGTGCCCTTCTATCTTTGCCTGGGAAATCCGAGACAGGTTGCTGTCTGAGGGAGTCTGTACCAACGACAATATCCCCAGTGTGTCATCAATAAACCGAGTGCTGCGCAACCTGGCAAGCGATAAGCAACAGATGGGATCGGAAGGGATGTATGACAAGCTCAGGATGCTCAATGGACAAACTGCAACTTGGGGGTCGCGGCCAGGGTGGTACCCGGGCACCTCAGTACCTGGCCAACCAGCACAGGAGGGGTGTCAGCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)