Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:3743895-IMAGp.5                18 PI      92         46      333                Protein WWC1 (WW domain-containing protein 1)

 This cluster: approximate FL confidence score = 0%

 1012790942 Xl3.1-PBX0026B02.5 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-PBX0026B02.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTAGACAAGTGGAGAAACAGGTACATAAGATCGAGCAGAAATATGAGATGCAGGCAGATAAGATGATGAGAGCAGCAGCAAAGGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCTTTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGGCCAAGAATGAACCTTCCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTATATATATTTTTTTCTGTTCTGAGCACCACGGCAAAGGAAAGTGCCGCCTGGTGCAGCTGAAATTGTGTGGTGTAATGAAGGTACAGAGTTCCCTGTCACTTACAATTTAGGTACGACAACATAAGTGGATGTTTTTATTTTTTTTTCATCATTATTACAAAATCAGCATTCCAAGTTTGTATAGCTTGTATATTTAGCGCCTTATTTTCAGAGAAAGAGAATCAGATGTTGTTGTGTGTGCGCAAAGTATAACTTTTGTACAGTCCGCTGCAGAGGTTTTTGATGCAATAAAATTAAATTAAAAGAGACTTAGTTCATACGTATATTGTGCGCTATATTAGTCACACAAATTTTTGGCCATTGACTATTTTGTATCGGATGTTTTAGCAAATGCGTTCTAGATCATAAGTGTTAAATAGACATTTTTATGATATAATACAGTTGAAAATATATTTTGAAATGCAC
                                                  Xl3.1-CHK-1012704221                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGTGGAGAAACAGGTACATAAGATCGAGCAGAAATATGAGATGCAGGCAGATAAGATGATGAGAGCAGCAGCAAAGGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCTTTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGGCCAAGAATGAACCTTCCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGTATTTTATATATATTTTTTTCTGTTCTGAGCACCACGGCAAAGGAAAGTGCCGCCTGGTGCAGCTGAAATTGTGTGGTGTAATGAAGGTACAGAGTTCCCTGTCACTTACAATTTAGGTACGACAACATAAGTGGATGTTTTTATTTTTTTTTCATCATTATTACAAAATCAGCATTCCAAGTTTGTATAGCTTGTATATTTAGCGCCTTATTTTCAGAGAAAGAGAATCAGATGTTGTTGTGTGTGCGCAAAGTATAACTTTTGTACAGTCCGCTGCAGAGGTTTTTGATGCAATAAAATTAAATTAAAAGAGACTTAGTTCATACGTATATTGTGCGCTATATTAGTCACACAAATTTTTGGCCATTGACTATTTTGTATCGGATGTTTTAGCAAATGCGTTCTAGATCATAAGTGTTAAATAGACATTTTTATGATATAATACAGTTGAAAATATATTTTGAAATGCACTTACCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     2     2     2     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       ...PREDICTED - Dr ---- 6e-017     XP_689275.3 PREDICTED: similar to Protein WWC1 (WW domain-containing protein 1) (Kidney and brain protein) (KIBRA) [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-023     NP_056053.1 KIBRA protein [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 3e-024     XP_536435.2 PREDICTED: similar to KIBRA protein [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 1e-024     XP_874065.2 PREDICTED: similar to KIAA0869 protein [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 8e-025     NP_740749.1 hypothetical protein LOC211652 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 4e-026     XP_414499.2 PREDICTED: similar to KIBRA protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 4e-032     A4IIJ3.1 Protein WWC1 (WW domain-containing protein 1) [Xenopus tropicalis]  ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 5e-033     AAH42930.1 Similar to cDNA sequence BC037006 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                    Xl3.1-PBX0026B02.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------ATGATG---------------------------------------------------------------------------------ATG---------------------ATG------------------------------TAATAA------TAA------------------------------------------------------------------TGA------------TAATGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------TAA------------------------------ATG---TAA---TAA---------------------------------------------------------------------------------ATG---TAG---ATG------------TAA---------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                        ]
  5   1   2      seed Ga15                               XL417d12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGCACAAAGCCAGTATATTTGCCGGCTGAATCGCAGTGATAGTGACAGCTCAACTCTATCTAAAAAGCCCCCTTTTGTCAGGAGTGCAGTGGAGAGACGCAGCGTGAGAGTCAAACGGCCACCTGTGAAGTCCAGCGGCTCAGAGCGACTAATTCGTACATCTCTCGATCTCGAGTTAGATCTGCAAGCTTCAAGGATGTGGAACCATCAGCTGACGCAAGAGATTTCTGTACTAAGGGAACTGAAAGAACAGTTAGAGCAAGCAAAGCGCCTGGGTGAGAATGAGCTACCTCAGCGGGTGAAGGATGATGACACGTTTAAGCTACTGCTTAGACAAGTGGAGAAACAGGTACATAAGATCGAGCAGAAATATGAGATGCAGGCAGATAAGATGATGAGAGCAGCAGCAAAGGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCTTTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGGCCAAGAATGAACCTTCCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGtattttatatatatttttttCTGTTCTGAGCACCACGGCAAAGGAAAGTGCCGCCTGGTGCAGCTGAAATTGTGTGGTGTAATGAAGGTACAGAGTTCCCTGTCACTTACAATTTAGGTACGACAACATAAGTGGATGtttttatttttttttCATCATTATTACAAAATCA
  5   1   2       bld Egg1                               PBX0026B02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTAGACAAGTGGAGAAACAGGTACATAAGATCGAGCAGAAATATGAGATGCAGGCAGATAAGATGATGAGAGCAGCAGCAAAGGATGTGCACAGGTTACGAGGGCAGAGCAGCAAGGAGCCTTTGGAGGTGCAGTCATTCAGAGAGAAGATGGCATTTTTCACTCGGCCAAGAATGAACCTTCCTACACTCACAGCAGATGATGTTTAATAATCACCATAAAGtattttatatatatttttttCTGTTCTGAGCACCACGGCAAAGGAAAGTGCCGCCTGGTGCAGCTGAAATTGTGTGGTGTAATGAAGGTACAGAGTTCCCTGTCACTTACAATTTAGGTACGACAACATAAGTGGATGTTTGTATTTCTTTTTCATCATTATTACAAAATCAGCATTCCAAGTTTGTATAGC
  3  -1   2       bld Ov1       in                    IMAGE:5048560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTTTTTTTTTTTTTTCGGGTCGGAGCACCACGGCAAAGGAAAGTGCCGCCTGGTGCAGCTGAAATTGTGTGGTGTAATGAAGGTACAGAGTTCCCTGTCACTTACAATTTAGGTACGACAACATAAGTGGATGTTTTTATTTTTTTTTCATCATTATTACAAAATCAGCATTCCAAGTTTGTATAGCTTGTATATTTAGCGCCTTATTTTCA
  5  -1   2       bld Ov1       in                    IMAGE:5048560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGTGCCGCCTGGTGCAGCTGAAATTGTGTGGTGTAATGAAGGTACAGAGTTCCCTGTCACTTACAATTTAGGTACGACAACATAAGTGGATGtttttatttttttttCATCATTATTACAAAATCAGCATTCCAAGTTTGTATAGCTTGTATATTTAGCGCCTTATTTTCAGAGAAAGAGAATCAGATGTTGTTGTGTGTGCGCAAAGTATAACTTTTGTACAGTCCGCTGCAGAGGTTTTTGATGCAATAAAATTAAATTAAAAGAGACTTAGTTCATACGTATATTGTGCGCTATATTAGTCACACAAATTTTTGGCCATTGACTATTTTGTATCGGATGTTTTAGCAAATGCGTTCTAGATCATAAGTGTTAAATAGACATTTTTATGATATAATACAGTTGAAAATATATTTTGAAATGCACTTACCACATTGTGGCCCCCTTCCCCCATGGAAAGACGTATGAAGaaaaaaaaaaaaaaaGGGCGCCGCTCG
  3   1   1       add Sp1                             IMAGE:4964666.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTATTTTCAGAGAAAGAGAATCAGATGTTGTTGTGTGTGCGCAAAGTATCACTTTTGTACAGTCCGCTGCAGAGGTTTTTGATGCAATAAAATTAAATTAAAAGAGACTAAGTTCATATATTGTGTGCTGTATTAGTCACACAACTTTTTGGCCATTGAATATTTTGTATCGGATGTTTTAGCAAATGCGTTCTAGATCATAAGTGTTAAATAGACATTTTTATGATATAATACAGTTGAAAATATATTTTGAAATGCACTCACCACATTGTGGCCCCTCCCTCCCACGGAAAGACGTATGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)