Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 84%

 1012791041 Xl3.1-IMAGE:5513683.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5513683.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTCGACCCACGCGTCCGCGGACGCGTCCGCCCACGCGTCCGCCAACTGCAAGTCGAGGCACACCACTGACATCCCTTTTGTTCTACTGCTAACCAGGTTAAGAACATCAGTGATTAATTCAGTACATTCCTTATCGGAGGCTCCGGCAATGCAGTTCCAGTATTAAGGTGGATTCCCATTTACTTTGTTTCCCTGGTTTATGTAAGAGGCTGCGCCGCTGTCATGGCTCTGAGATGGGGACCTTGCCTTCTGGGGACAGTGCTTGTCTCTTTGCTCTGCAGCCACATGGAGGCCTTTCAGATGCCTAAAGAATTAATGTATCCACCAACTATAACTGAACAGTCACCGGCAAAGTACGTGGTATATCCCAATGATGACATTGTGCTCAAGTGTGAAGCCAAGAGAAATGCAAAAGTAAAATACACCTGGAAAAAGGATGGGGAAACGTTTGCGCCAGAGGATGGCCCAAGTGTCAATCGCAAGAAAGATTCAGGATCTATAATCATCTCTAATGGGAATGGGAACGCAATGAAGGATTTTCAGGGCAAATATCGTTGCTATGCCACCAATGAACTGGGAACAGCCATCTCACACGAGATCCATGTAATCACTGAGAGCACCCCAAAATGGCAGAAGGAAATGATCCGTCCTATTGAGGTTGAAGAGGGTTCCTCATTGATATTACCGTGTAATCCACCTAAAGTGCCGTACCTCACGAGAGTCATCTGGATGAACAGCAGCTTATTGCACATCACACAGGGATAAGCCGTGTGTCAAATGGGCGTTAAATGGGAAACCTTATATTTTCTCCAAATGTACAAAAAAGCCAGGACGGAACCATCCCTGGACTT
                                                  Xl3.1-CHK-1012710583                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCACGCGTCCGCGGACGCGTCCGCCCACGCGTCCGCCAACTGCAAGTCGAGGCACACCACTGACATCCCTTTTGTTCTACTGCTAACCAGGTTAAGAACATCAGTGATTAATTCAGTACATTCCTTATCGGAGGCTCCGGCAATGCAGTTCCAGTATTAAGGTGGATTCCCATTTACTTTGTTTCCCTGGTTTATGTAAGAGGCTGCGCCGCTGTCATGGCTCTGAGATGGGGACCTTGCCTTCTGGGGACAGTGCTTGTCTCTTTGCTCTGCAGCCACATGGAGGCCTTTCAGATGCCTAAAGAATTAATGTATCCACCAACTATAACTGAACAGTCACCGGCAAAGTACGTGGTATATCCCAATGATGACATTGTGCTCAAGTGTGAAGCCAAGAGAAATGCAAAAGTAAAATACACCTGGAAAAAGGATGGGGAAACGTTTGCGCCAGAGGATGGCCCAAGTGTCAATCGCAAGAAAGATTCAGGATCTATAATCATCTCTAATGGGAATGGGAACGCAATGAAGGATTTTCAGGGCAAATATCGTTGCTATGCCACCAATGAACTGGGAACAGCCATCTCACACGAGATCCATGTAATCACTGAGAGCACCCCAAAATGGCAGAAGGAAATGATCCGTCCTATTGAGGTTGAAGAGGGTTCCTCATTGATATTACCGTGTAATCCACCTAAAGTGCCGTACCTxxCxxGAGTCATCTGGATGAACAGCAGCTTATTGCACATCACACAGGGATAAGCCGTGTGTCAAATGGGCGTTAAATGGGAAACCTTATATTTTCTCCAAATGTACAAAAAAGCCAGGACGGAACCATCCCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1
                                               BLH ATG     223      68                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     223      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     223     232                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     223       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Sp ---- 2e-007     XP_001186764.1 PREDICTED: similar to hemicentin [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ag ==== 4e-009     XP_311259.4 AGAP000720-PA [Anopheles gambiae str. PEST] ==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---= 1e-009     NP_996380.1 CG1634-PC, isoform C [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 4e-017     NP_001023497.1 L1 CAM ADhesion molecule homolog family member (lad-2) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - ?? ---- 5e-029     XP_590378.4 PREDICTED: similar to Neurofascin [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Dr ==== 3e-031     XP_001923328.1 PREDICTED: sc:d0205 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ==== 8e-038     NP_990484.1 neuron-glia cell adhesion molecule (Ng-CAM) [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 5e-043     NP_032504.3 L1 cell adhesion molecule [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 3e-044     NP_076493.1 L1 cell adhesion molecule isoform 2 precursor; neural cell adhesion molecule L1;antigen identified by monoclonal antibody R1 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ---- 2e-044     XP_001250424.1 PREDICTED: similar to cell adhesion molecule L1 isoform 1 [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Cf ---- 1e-044     XP_549364.2 PREDICTED: similar to Neural cell adhesion molecule L1 precursor (N-CAM L1) (CD171 antigen) [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 5e-084     NP_001096185.1 L1 cell adhesion molecule [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 2e-087     AAH73282.1 Unknown (protein for MGC:80658) [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5513683.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA---------------------------------------------TAA---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------TAA------------ATG---------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2       bld Sp1  5g                         IMAGE:5506980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTCGACCCACGCGTCCGCGGACGCGTCCGCCCACGCGTCCGCCAACTGCAAGTCGAGGCACACCACTGACATCCCTTTTGTTCTACTGCTAACCAGGTTAAGAACATCAGTGATTAATTCAGTACATTCCTTATCGGAGGCTCCGGCAATGCAGTTCCAGTATTAAGGTGGATTCCCATTTACTTTGTTTCCCTGGTTTATGTAAGAGGCTGCGCCGCTGTCATGGCTCTGAGATGGGGACCTTGCCTTCTGGGGACAGTGCTTGTCTCTTTGCTCTGCAGCCACATGGAGGCCTTTCAGATGCCTAAAGAATTAATGTATCCACCAACTATAACTGAACAGTCACCGGCAAAGTACGTGGTATATCCCAATGATGACATTGTGCTCAAGTGTGAAGCCAAGAGAAATGCAAAAGTAAAATACACCTGGAAAAAGGATGGGGAAACGTTTGCGCCAGAGGATGGCCCAAGTGTCAATCGCAAGAAAGATTCAGGATCTATAATCATCTCTAATGGGAATGGGAACGCAATGAAGGATTTTCAGGGCAAATATCGTTGCTATGCCACCAATGAACTGGGAACAGCCATCTCACACGAGATCCATGTAATCACTGAGAGCACCCCAAAATGGCAGAAGGAAATGATCCGTCCTATTGAGGTTGAAGAGGGTTCCTCATTGATATTACCGTGTAATCCACCTAAAGTGCCGTACCTCACGAGTCTCTGGATGAACAGCAGCTTATGCACATCCACGGATAGCGTGTGTCATGGCGTAATGGAACTATTTCTCATGTCAAGCAGACAC
  5   1   2      seed Sp1  5g                         IMAGE:5513683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCATTCAGCGGCAGCTACCAACCCCAACTGCAAGTCGAGGCACACCACTGACATCCCTTTTGTTCTACTGCTAACCAGGTTAAGAACATCAGTGATTAATTCAGTACATTCCTTATCGGAGGCTCCGGCAATGCAGTTCCAGTATTAAGGTGGATTCCCATTTACTTTGTTTCCCTGGTTTATGTAAGAGGCTGCGCCGCTGTCATGGCTCTGAGATGGGGACCTTGCCTTCTGGGGACAGTGCTTGTCTCTTTGCTCTGCAGCCACATGGAGGCCTTTCAGATGCCTAAAGAATTAATGTATCCACCAACTATAACTGAACAGTCACCGGCAAAGTACGTGGTATATCCCAATGATGACATTGTGCTCAAGTGTGAAGCCAAGAGAAATGCAAAAGTAAAATACACCTGGAAAAAGGATGGGGAAACGTTTGCGCCAGAGGATGGCCCAAGTGTCAATCGCAAGAAAGATTCAGGATCTATAATCATCTCTAATGGGAATGGGAACGCAATGAAGGATTTTCAGGGCAAATATCGTTGCTATGCCACCAATGAACTGGGAACAGCCATCTCACACGAGATCCATGTAATCACTGAGAGCACCCCAAAATGGCAGAAGGAAATGATCCGTCCTATTGAGGTTGAAGAGGGTTCCTCATTGATATTACCGTGTAATCCACCTAAAGTGCCGTACCTCACGAGTCATCTGGATGA
  5   1   1       add Eye1                            IMAGE:7020051.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACCAACCCCAACTGCAAGTTGAGGCACACCACTGACATCCCTTTTGTTCTACTGCTAACCAGGTTAAGAACATCAGTGCTTAATTCAGTACATTCCTTATCGGAGGCTCCGGCAATGCAGTTCCAGTATTAAGGTGGATTCCCATTTACTTTGTTTCCCTGGTTTATGTAAGAGGCTGCGCCGCTGTCATGGCTCTGAGATGGGGACCTTGCCTTCTGGGGACAGTGCTTGTCTCTTTGCTCTGCAGCCACATGGAGGCCTTTCAGATGCCTAAAGAATATGTAATGCAAGAAATAATGTATCCACCAACTATAACTGAACAGTCACCGGCAAAGTACGTGGTATATCCCAATGATGACATTGTGCTCAAGTGTGAAGCCAAGAGAAATGCAAAAGTAAAATACACCTGGAAAAAGGATGGGGAAACGTTTGCGCCAGAGGATGGCCCAAGTGTCAATCGCAAGAAAGATTCAGGATCTATAATCATCTCTAATGGGAATGGGAACGCAATGAAGGATTTTCAGGGCAAATATCGTTGCTATGCCACCAATGAACTGGGAACAGCCATCTCACACGAGATCCATGTAATCACTGAGAGCACCCCAAAATGGCAGAAGGAAATGATCCGTCCTATTGAGGTTGAAGAGGGTTCCTCATTGATATTACCGTGTAATCCACCTAAAAGTGCCGTACCTCCACGAGTCATCTGGATGAACAGCAGCTTATTGCACATCACACAGGGATAAGCCGTGTGTCAAATGGGCGTTAAATGGGAAACCTTATATTTTCTCCAAATGTACAAAAAAGCCAGGACGGAACCATCCCTGGACTTACCTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)