Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL200c23.5                            4 END     4          80      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL068e20.5                           77 PI      84        388      557                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6867382.5                      76 PI      76        219      568                hypothetical protein LOC594866 [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:5156387.5                      70 PI      79        232      568                (no blast hit)
     5   0.0    0Xl3.1-XL193p07.3.5                         58 PI      81        227      568                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:8531562.3.5                    40 PI      80        333      558                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:5074071.5                      40 PI      79        244      501                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:3378224-IMAGp.5                37 PI      82        317      557                (no blast hit)
     9   0.0    0Xl3.1-IMAGE:6956558.5.5                    35 PI      89        327      568                MGC84281 protein [Xenopus laevis]
    10   0.0    0Xl3.1-XL098d11.3.5                         27 PI      79        317      549                (no blast hit)
    11   0.0    0Xl3.1-xl223g19.5                           25 PI      86        400      555                (no blast hit)
    12   0.0    0Xl3.1-IMAGE:6322860.5                      24 PI      76        232      544                (no blast hit)
    13   0.0    0Xl3.1-XL188f04.3                           18 PI      78        236      558                (no blast hit)
    14   0.0    0Xl3.1-IMAGE:6325838.5                      14 PI      93        425      568                (no blast hit)
    15   0.0    0Xl3.1-XL463p09ex.5                         14 PI      83        385      568                (no blast hit)
    16   0.0    0Xl3.1-XL036k15.3                           13 PI      78        282      554                (no blast hit)
    17   0.0    0Xl3.1-xl300m16.3                           12 PI      82        317      568                (no blast hit)
    18   0.0    0Xl3.1-IMAGE:5571993.5                      11 PI      87        317      489                (no blast hit)
    19   0.0    0Xl3.1-rxlk159f02ex.3                       11 PI      84        379      568                (no blast hit)
    20   0.0    0Xl3.1-XL495c10ex.3                         11 PI      83        333      544                (no blast hit)
    21   0.0    0Xl3.1-IMAGE:6638180.5                      11 PI      82        323      556                (no blast hit)
    22   0.0    0Xl3.1-IMAGE:3379187.3                      11 PI      81        317      556                (no blast hit)
    23   0.0    0Xl3.1-IMAGE:8548910.5                      10 PI      79        232      536                (no blast hit)
    24   0.0    0Xl3.1-IMAGE:5048716.3.5                    10 PI      79        317      554                (no blast hit)
    25   0.0    0Xl3.1-XL155j22.3                            9 PI      78        249      517                (no blast hit)
    26   0.0    0Xl3.1-XL058o11.3                            8 PI      86        354      568                (no blast hit)
    27   0.0    0Xl3.1-IMAGE:7011866.5                       8 PI      85        355      568                (no blast hit)
    28   0.0    0Xl3.1-xlnga001k15.3                         8 PI      83        355      568                (no blast hit)
    29   0.0    0Xl3.1-xlk140g05ex.3.5                       8 PI      80        317      568                (no blast hit)
    30   0.0    0Xl3.1-XL427b15ex.3                          7 PI      88        391      553                (no blast hit)
    31   0.0    0Xl3.1-PBX0014A12.5                          7 PI      87        400      556                (no blast hit)
    32   0.0    0Xl3.1-XL006o24.3                            7 PI      84        354      566                (no blast hit)
    33   0.0    0Xl3.1-IMAGE:3379378-IMAGp.5                 7 PI      83        337      558                (no blast hit)
    34   0.0    0Xl3.1-XL016l18.5                            7 PI      81        246      535                Centromere protein O [Xenopus tropicalis]
    35   0.0    0Xl3.1-xlk7j11ex.3                           7 PI      75        219      525                (no blast hit)
    36   0.0    0Xl3.1-IMAGE:6957507.3                       6 PI      83        238      562                (no blast hit)
    37   0.0    0Xl3.1-xl302j01.3                            6 PI      83        317      558                (no blast hit)
    38   0.0    0Xl3.1-IMAGE:8641197.3                       6 PI      81        321      549                (no blast hit)
    39   0.0    0Xl3.1-xl306o04.3                            6 PI      81        317      544                (no blast hit)
    40   0.0    0Xl3.1-IMAGE:5161977.5                       6 PI      81        354      548                (no blast hit)
    41   0.0    0Xl3.1-IMAGE:8463246.3                       6 PI      80        317      558                (no blast hit)
    42   0.0    0Xl3.1-xlk73h07ex.5                          6 PI      76        227      568                hypothetical protein LOC496835 [Xenopus tropicalis]
    43   0.0    0Xl3.1-XL164e02.3                            5 PI      91        418      568                (no blast hit)
    44   0.0    0Xl3.1-XL078j01.5                            5 PI      90        425      568                (no blast hit)
    45   0.0    0Xl3.1-xlk102a10ex.3                         5 PI      85        385      556                (no blast hit)
    46   0.0    0Xl3.1-XL444c03ex.5.5                        5 PI      82        324      568                (no blast hit)
    47   0.0    0Xl3.1-IMAGE:4755676-IMAGp.5                 5 PI      79        322      556                (no blast hit)
    48   0.0    0Xl3.1-IMAGE:4785748.5                       5 PI      78        247      558                (no blast hit)
    49   0.0    0Xl3.1-IMAGE:5049431.5                       5 PI      77        232      525                (no blast hit)
    50   0.0    0Xl3.1-IMAGE:6940784.5                       5 PI      76        219      558                (no blast hit)
    51   0.0    0Xl3.1-IMAGE:5514118.5                       5 PI      76        232      554                (no blast hit)
    52   0.0    0Xl3.1-XL023a08.3                            5 PI      75        218      539                (no blast hit)
    53   0.0    0Xl3.1-IMAGE:3398035-IMAGp.5                 4 PI      91        365      565                (no blast hit)
    54   0.0    0Xl3.1-IMAGE:3380172-IMAGp.5                 4 PI      89        355      556                (no blast hit)
    55   0.0    0Xl3.1-IMAGE:7204730.5                       4 PI      85        317      558                (no blast hit)
    56   0.0    0Xl3.1-IMAGE:6875212.5                       4 PI      83        315      549                (no blast hit)
    57   0.0    0Xl3.1-IMAGE:3748918-IMAGp.5                 4 PI      83        363      568                (no blast hit)
    58   0.0    0Xl3.1-xlnga001h04.3                         4 PI      82        317      568                (no blast hit)
    59   0.0    0Xl3.1-XL486m20ex.5                          4 PI      82        317      568                PREDICTED: similar to MGC137074 protein [Bos taurus]
    60   0.0    0Xl3.1-xl287m12.5                            4 PI      82        321      568                MGC84611 protein [Xenopus laevis]
    61   0.0    0Xl3.1-IMAGE:6956638.3                       4 PI      81        317      557                (no blast hit)
    62   0.0    0Xl3.1-xlk101m18ex.3                         4 PI      81        321      558                (no blast hit)
    63   0.0    0Xl3.1-IMAGE:6950277.5                       4 PI      81        357      557                (no blast hit)
    64   0.0    0Xl3.1-IMAGE:8074818.3                       4 PI      80        261      505                (no blast hit)
    65   0.0    0Xl3.1-IMAGE:3557044-IMAGp.5                 3 PI      84        379      559                (no blast hit)
    66   0.0    0Xl3.1-IMAGE:5512772.5                       3 PI      83        317      544                (no blast hit)
    67   0.0    0Xl3.1-IMAGE:4740904.3                       3 PI      83        322      544                (no blast hit)
    68   0.0    0Xl3.1-IMAGE:3474975-IMAGp.5                 3 PI      83        317      533                Unknown (protein for IMAGE:7573129) [Xenopus tropicalis]
    69   0.0    0Xl3.1-XL040d03.5                            3 PI      81        227      568                (no blast hit)
    70   0.0    0Xl3.1-IMAGE:3380469-IMAGp.5                 3 PI      81        317      558                (no blast hit)
    71   0.0    0Xl3.1-IMAGE:4432877.3                       3 PI      80        317      558                (no blast hit)
    72   0.0    0Xl3.1-IMAGE:4968853.5                       3 PI      80        317      556                (no blast hit)
    73   0.0    0Xl3.1-XL021n20.3                            3 PI      80        352      558                (no blast hit)
    74   0.0    0Xl3.1-IMAGE:5515325.5                       3 PI      79        324      548                (no blast hit)
    75   0.0    0Xl3.1-IMAGE:3475702.5                       3 PI      78        317      568                (no blast hit)
    76   0.0    0Xl3.1-XL487c14ex.3                          3 PI      74        228      568                (no blast hit)
    77   0.0    0Xl3.1-IMAGE:4959700.3                       2 PI      89        425      567                PREDICTED: similar to novel G protein-coupled receptor protein [Danio rerio]
    78   0.0    0Xl3.1-XL510e21ex.3                          2 PI      83        317      568                (no blast hit)
    79   0.0    0Xl3.1-IMAGE:3200850.3                       2 PI      83        369      556                (no blast hit)
    80   0.0    0Xl3.1-IMAGE:4963632.5                       2 PI      82        354      568                (no blast hit)
    81   0.0    0Xl3.1-IMAGE:6318750-IMAGp.5                 2 PI      82        385      568                (no blast hit)
    82   0.0    0Xl3.1-IMAGE:3747847.5                       2 PI      81        244      539                (no blast hit)
    83   0.0    0Xl3.1-XL202j13.5                            2 PI      80        317      558                (no blast hit)
    84   0.0    0Xl3.1-IMAGE:4743595.5                       2 PI      80        321      558                (no blast hit)
    85   0.0    0Xl3.1-XL487h12ex.3                          2 PI      80        351      544                (no blast hit)
    86   0.0    0Xl3.1-XL204b16.5                            2 PI      79        212      568                (no blast hit)
    87   0.0    0Xl3.1-XL176f23.5                            2 PI      79        323      558                (no blast hit)
    88   0.0    0Xl3.1-XL164a07.5                            2 PI      77        236      541                (no blast hit)
    89   0.0    0Xl3.1-xlk116h13ex.3                         2 PI      76        247      558                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012791284 Xl3.1-XL200c23.3 - 5 ESTs
                                                                       .......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL200c23.3                                                                                                                                                    TGGATCAGGAACATGTACTTAGTATCTTACTCATTAGTTAGGATATACGTTACTTGGATTTTTTGTGACATTACTTTATATACAAACACTTGAATAAGGATGAGAGGTCCAAGTTTTTCCAGTATTGTATTAGAGACTACTACCAGTTACTGAATTATCTGTTTGTTCGCTAGTATTATTTTGGTGTTCCTTAAATTAAACACAAACATACAATATCTTTAATGGAGTGGCTCATCTTTAAGGTAACTTTTATTATGTTATAGAACGGCCAATTCTTAGCAACTTTTCAATTGGTTTTCATTATTTTTTATAGTTATTTGCAGCTTTCAAATGGGCGTCACTGACTCCCTTCTAAAAAACATATGCTCTGTAAGGCTGCAAATGTATTGTTATTGTTACTTTTTATTACTGATCCTCTTCAGCCCCTCTCCTTTTCATATTCCAGTCTCTTATTCAAATCAATGCATGGTTGCTAGGGTAATTTGGACCCTTGTTACCAGATTGCTTAAGATGCAAATTGAAGAGCTGCTGAATAAAAAGCTAACTAACTCAAAAACCTTCAATAATACATTTTTAAATTGCAGGTAAAGTTGCTGTACCGTGTTAGCCAGT
                                                  Xl3.1-CHK-1012705877                                                                                                                                                          AGGAACATGTACTTAGTATCTTACTCATTAGTTAGGATATACGTTACTTGGATTTTTTGTGACATTACTTTATATACAAACACTTGAATAAGGATGAGAGGTCCAAGTTTTTCCAGTATTGTATTAGAGACTACTACCAGTTACTGAATTATCTGTTTGTTCGCTAGTATTATTTTGGTGTTCCTTAAATTAAACACAAACATACAATATCTTTAATGGAGTGGCTCATCTTTAAGGTAACTTTTATTATGTTATAGAACGGCCAATTCTTAGCAACTTTTCAATTGGTTTTCATTATTTTTTATAGTTATTTGCAGCTTTCAAATGGGCGTCACTGACTCCCTTCTAAAAAACATATGCTCTGTAAGGCTGCAAATGTATTGTTATTGTTACTTTTTATTACTGATCCTCTTCAGCCCCTCTCCTTTTCATATTCCAGTCTCTTATTCAAATCAATGCATGGTTGCTAGGGTAATTTGGACCCTTGTTACCAGATTGCTTAAGATGCAAATTGAAGAGCTGCTGAATAAAAAGCTAACTAACTCAAAAACCTTCAATAATACATTTTTAAATTGCAGGTAAAGTTGCTGTACCGTGTTAGCCAGTAAAAAT
                                                      consensus depths                                                                                                                                                         2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     4     5     4     5     4     5     4     5     4     5     3     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                      Xl3.1-XL200c23.3                                                                                                                                                                ATG---------------------------------------------------------------------------TGA------ATG------------------------------------------------TGA------------------------------------------------------------------TAA---------------------TAA------------------------------TAG---------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                          ]
  3   1   2      seed Ga12      out                        XL200c23.3p CTGATACATNGTTTCAGGTGACAGAACCAGAAGTGCAGAGAATACAATCAGACAGAAGCTGCAATTAGGTTTGCAAATACCTTTTAAGCAATTTGATTGTTCTTTAAAAACTGTTTAGTAACTTGTTTACTCCATGATTTGAAGTTGTGGATCAGGAACATGTACTTAGTATCTTACTCATTAGTTAGGATATACGTTACTTGGATTTTTTGTGACATTACTTTATATACAAACACTTGAATAAGGATGAGAGGTCCAAGTTTTTCCAGTATTGTATTAGAGACTACTACCAGTTACTGAATTATCTGTTTGTTCGCTAGTATTATTTTGGTGTTCCTTAAATTAAACACAAACATACAATATCTTTAATGGAGTGGCTCATCTTTAAGGTAACTTTTATTATGTTATAGAACGGCCAATTCTTAGCAACTTTTCAATTGGTTTTCATTATTTTTTATAGTTATTTGCAGCTTTCAAATGGGCGTCACTGACTCCCTTCTAAAAAACATATGCTCTGTAAGGCTGCAAATGTATTGTTATTGTTACTTTTTATTACTGATCCTCTTCAGCCCCTCTCCTTTTCATATTCCAGTCTCTTATTCAAATCAATGCATGGTTGCTAGGGTAATTTGGACCCTTGTTACCAGATTGCTTAAGATGCAAATTGAAGAGCTGCTGAATAAAAAGCTAACTAACTCAAAAACCTTCAATAATACATTTTTAAATTGCAGGTAAAGTTGCTGTACCGTGTTAGCCAGTAAAAAT
  3   1   2      skin Ga12      out                        XL161f06.3p                GGTGACAGAACCAGAAGTGCAGAGAATACAATCAGACAGAAGCTGCAATTAGGTTTGCAAATACCTTTTAAGCAATTTGATTGTTCTTTAAAAACTGTTTAGTAACTTGTTTACTCCATGATTTGAAGTTGTGGATCAGGAACATGTACTTAGTATCTTACTCATTAGTTAGGATATACGTTACTTGGATTTTTTGTGACATTACTTTATATACAAACACTTGAATAAGGATGAGAGGTCCAAGTTTTTCCAGTATTGTATTAGAGACTACTACCAGTTNCTGAATTATCTGTTTGTTCGCTAGTATTATTTTGGTGTTCCTTAAATTAAACNTCAAACATACAATATCTTTAATGGAGTGGCTCATCTTTAAGGTAACTTTTATTATGTTATAGAACGGCCAATTCTTAGCAACTTTTCAATTGGTTTTCATTATTTTTTATAGTTATTTGCAGCTTTCAAATGGGCGTCACTGACTCCCTTCTAAAAAACATATGCTCTGTAAGGCTGCAAATGTATTGTTATTGTTACTTTTTATTACTGATCCTCTTCAGCCCCTCTCCTTTTCATATTCCAGTCTCTTATTCAAATCAATGCATGGTTGCTAGGGTAATTTGGACCCTTGTTACCAGATTGCTTAAGATGCAAATTGAAGAGCTGCTGAATAAAAAGCTAACTAACTCAAAAACCTTCAATAATACATTTTTAAATTGCAGGTAAAGTTGCTGTACCGTGTTAGCCAGTAAAAAT
  3   1   2       bld Ga12      out                        XL178g18.3p                                                                                                                                             GAAGTTGTGGATCAGGAACATGTACTTAGTATCTTACTCATTAGTTAGGATATACGTTACTTGGATTTTTTGTGACATTACTTTATATACAAACACTTGAATAAGGATGAGAGGTCCAAGTTTTTCCAGTATTGTATTAGAGACTACTACCAGTTACTGAATTATCTGTTTGTTCGCTAGTATTATTTTGGTGTTCCTTAAATTAAACACAAACATACAATATCTTTAATGGAGTGGCTCATCTTTAAGGTAACTTTTATTATGTTATAGANCGGCCAATTCTTAGCAACTTTTCAATTGGTTTTCATTATTTTTTATAGTTATTTGCAGCTTTCAAATGGGCGTCACTGACTCCCTTCTAAAAAACATATGCTCTGTAAGGCTGCAAATGTATTGTTATTGTTACTTTTTATTACTGATCCTCTTCAGCCCCTCTCCTTTTCATATCCCAGTCTCTTATTCAAAGC
  3   1   2       add Ga12      out                        XL179g18.3p                                                                                                                                                                                                                                                                                                                                         GGTGTTCCTATAAATTAAACNCAAACATACAATATCTTTAATGGAGTGGCTCATCNTTAAGGTAACTNTTATTATGTTATAGAGCGGCCAATTCTTAGCAACTTNTCAATTGGTTTTCANTATTNNNGATAGTTANCTGCAGCTTTCAAATGGGCGTCACTGACTCCCTTGTAAAANACATATGCTCCGTAAGGCTGCAAATGTATTGTTANTGTTACNTNTNAGTACTGATCC
  3   1   2       add Ga12                                 XL202c23.3p                                                                                                                                                                                                                                                                                                                                                             CAAACATACAATATNTTTAATGGAGNGGCTCATCTTTAAGGTAACTTTTATTATGTTATAGAACGGCCAATTCTTAGCAACTTTTCAATTGGTTTTCATTATTTTCTTATAGTTATTNGCAGCTTTCAAATGGGCGTCACTGACTCCCTTCTAAAAAACATATGCTCTGTAAGGCTGCAAATGTATTGTTATTGTTACTTTTTATTACTGATCCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)