Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL098i03.3                            2 END     2          66      100                hypothetical protein LOC734920 [Xenopus laevis]

 This cluster: approximate FL confidence score = 90%

 1012791507 Xl3.1-IMAGE:7979341.5 - 3 ESTs
                                                                       .....-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7979341.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGGCAATTCGGCACGAGGCTCCAAGGNCGATCAATCGCATCTCAGGCGTCCTCCAAGCGCTCTCTTACGTCTCCCTCCAGCAGGAGAGAGAACTGACACTACACTGGGGCTGATCAGTTCATCAGCTTTTTTTACCTGCCTTGGTCGCTGAACCATGTCGTTGAGCCCAAAGCATACTACACCCTTCTCAGTGACTGACATCTTGAGTCCCATTGAAGAGACCTACAAAAAATTTGGTGCCATGGAAAGCGCTGGAAACCTGAGCAGCCCCTTGGGAGGCTACAGACAGACACACGTCTCCCAGACTGGCATGCAACAGCACAGCATGGGCCACAATGTCACCACCACCACCTACCACATGCCACACACTGTCACCCAGTTCTCACATGGCACAATGAGTGGCTACTGCAATGGGGGCATTGGCAACATGGGAGACATCCCTTCCTATCAAGACTCCATGAGAAATAGCGCAGCAACAGGCTGGTATGGAGCCAACACAGATCCCAGATACTCAACAATTTCTAGATTCATGGGACCGTCTACAGGGATGAACATGGCAGGCATGGGCACTTTGCAGGGCATAGCAGAAGCTGCCAAGTCTATGACTCCTCTCCATGCTGCTCCCAGAAGGAAAAGGAGAGTGCTCTTCTCTCAAGCGCAAGTTTATGAGTTGGAGAGGAGGTTCAAGCAGCAGAAGTATCTGTCAGCCCCCGAGAGAGAACACCTGGCCAGCATGATCCACCTCACTCCTACCCAGGTCAAGATCTGGTTCCAGAATCACAGGTACAAGATGAAGAGACAAGCCAAGGACAAGGTCACTCAACAGCTACAACAGGACAACAATTTGTGTCAACAGCAATCCCCCCGTAGAGTTGCTGTGCCAGTCTTGGTGAAAGATGGCAAGCCTTG
                                                  Xl3.1-CHK-1012710030                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATTCGGCACGAGGCTCCAAGGNCGATCAATCGCATCTCAGGCGTCCTCCAAGCGCTCTCTTACGTCTCCCTCCAGCAGGAGAGAGAACTGACACTACACTGGGGCTGATCAGTTCATCAGCTTTTTTTACCTGCCTTGGTCGCTGAACCATGTCGTTGAGCCCAAAGCATACTACACCCTTCTCAGTGACTGACATCTTGAGTCCCATTGAAGAGACCTACAAAAAATTTGGTGCCATGGAAAGCGCTGGAAACCTGAGCAGCCCCTTGGGAGGCTACAGACAGACACACGTCTCCCAGACTGGCATGCAACAGCACAGCATGGGCCACAATGTCACCACCACCACCTACCACATGCCACACACTGTCACCCAGTTCTCACATGGCACAATGAGTGGCTACTGCAATGGGGGCATTGGCAACATGGGAGACATCCCTTCCTATCAAGACTCCATGAGAAATAGCGCAGCAACAGGCTGGTATGGAGCCAACACAGATCCCAGATACTCAACAATTTCTAGATTCATGGGACCGTCTACAGGGATGAACATGGCAGGCATGGGCACTTTGCAGGGCATAGCAGAAGCTGCCAAGTCTATGACTCCTCTCCATGCTGCTCCCAGAAGGAAAAGGAGAGTGCTCTTCTCTCAAGCGCAAGTTTATGAGTTGGAGAGGAGGTTCAAGCAGCAGAAGTATCTGTCAGCCCCCGAGAGAGAACACCTGGCCAGCATGATCCACCTCACTCCTACCCAGGTCAAGATCTGGTTCCAGAATCACAGGTACAAGATGAAGAGACAAGCCAAGGACAAGGTCACTCAACAGCTACAACAGGACAACAATTTGTGTCAACAGCAATCCCCCCGTAGAGTTGCTGTGCCAGTCTTGGTGAAAGATGGCAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                             1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1
                                               BLH ATG     157     133                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH MIN     157     113                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH OVR     157     221                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               ORF LNG     157      10                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 6e-027     NP_506419.3 C.Elegans Homeobox family member (ceh-24) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ag ---- 4e-031     XP_552227.3 AGAP012001-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ci ==== 2e-046     BAE06740.1 transcription factor protein [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 2e-056     NP_001015473.1 CG17594-PA.3 [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Sp ==== 1e-058     NP_999800.1 homeodomain protein NK2.1 [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Cf ==== 1e-094     NP_001003260.1 thyroid transcription factor 1 [Canis lupus familiaris] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bt ---- 4e-095     XP_880071.2 PREDICTED: similar to thyroid transcription factor 1 isoform 4 [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 3e-098     NP_075993.1 NK2 transcription factor related, locus 4 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 6e-099     CAP59468.1 partial homeobox transcription factor Nkx2-4 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 3e-099     NP_149416.1 NK2 homeobox 4 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Gg ==== 5e-104     NP_989947.1 homeodomain protein NKx2.1 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 2e-125     XP_001923334.1 PREDICTED: similar to NK2 homeobox 4 isoform 2 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Xl ==== 9e-147     NP_001089854.1 hypothetical protein LOC734920 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7979341.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA---ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------ATG------------------------------ATG---------------------------------ATG------------------------------ATG---------------------------ATG---------------------------------------------------------------------ATG---------------ATG---ATG------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2       bld Tbd7 5g3  out                        XL098i03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGGCAATTCGGCACGAGGCTCCAAGGNCGATCAATCGCATCTCAGGCGTCCTCCAAGCGCTCTCTTACGTCTCCCTCCAGCAGGAGAGAGAACTGACACTACACTGGGGCTGATCAGTTCATCAGCTTTTTTTACCTGCCTTGGTCGCTGAACCATGTCGTTGAGCCCAAAGCATACTACACCCTTCTCAGTGACTGACATCTTGAGTCCCATTGAAGAGACCTACAAAAAATTTGGTGCCATGGAAAGCGCTGGAAACCTGAGCAGCCCCTTGGGAGGCTACAGACAGACACACGTCTCCCAGACTGGCATGCAACAGCACAGCATGGgccacaatgtcaccaccaccacctaccacatgccacacactgtcacccaGTTCTCACATGGCACAATGAGTGGCTACTGCAATGGGGGCATTGGCAACATGGGAGACATCCCTTCCTATCAAGACTCCATGAGAAATAGCGCAGCAACAGGCTGGTATGGAGCCAACACAGATCCCAGATACTCAACAATTTCTAGATTCATGGGACCGTCTACAGGGATGAACATGGCAGGCATGGGCACTTTGCAGGGCATAGCAGAAGCT
  5   1   2      seed Em10 5g                         IMAGE:7979341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCTCAGGCGTCCTCCAAGCGCTCTCTTACGTCTCCCTCCAGCAGGAGAGAGAACTGACACTACACTGGGGCTGATCAGTTCATCAGCTTTTTTTACCTGCCTTGGTCGCTGAACCATGTCGTTGAGCCCAAAGCATACTACACCCTTCTCAGTGACTGACATCTTGAGTCCCATTGAAGAGACCTACAAAAAATTTGGTGCCATGGAAAGCGCTGGAAACCTGAGCAGCCCCTTGGGAGGCTACAGACAGACACACGTCTCCCAGACTGGCATGCAACAGCACAGCATGGgccacaatgtcaccaccaccacctaccacatgccacacactgtcacccaGTTCTCACATGGCACAATGAGTGGCTACTGCAATGGGGGCATTGGCAACATGGGAGACATCCCTTCCTATCAAGACTCCATGAGAAATAGCGCAGCAACAGGCTGGTATGGAGCCAACACAGATCCCAGATACTCAACAATTTCTAGATTCATGGGACCGTCTACAGGGATGAACATGGCAGGCATGGGCACTTTGCAGGGCATAGCAGAAGCTGCCAAGTCTATGACTCCTCTCCATGCTGCTCCCAGAAGGAAAAGGAGAGTGCTCTTCTCTCAAGCGCAAGTTTATGAGTTGGAGAGGAGGTTCAAGCAGCAGAAGTATCTGTCAGCCCCCGAGAGAGAACACCTGGCAGCATGATCACCTCACTCCTACCAGTCAGATCTGGTTCAGATCACAGTACAGATGAGAGACAGCCAGGACAAGTCATCACACTACACAGACACATTGTGTACGCATCCCCCTAAGNCTTGCATCTGTGAGAGCAGCTGTGACGTCACCTACACACGCACATGAC
  5   1   2       bld Neu7      out                        XL009f12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAGGNAATTCGGCACGAGGGGAAACCTGANCAGCCCCTTGGGNAGGCTACAGACAGACACACGTCTCCCAGNACTGGCATGCAACAGCACAGCATGGgccacaatgtcaccaccaccacctaccacatgccacacactgtcacccaGTTCTCACATGGCACAATGAGTGGCTACTGCAATGGGGGCATTGGCAACATGGGAGACATCCCTTCCTATCAAGACTCCATGAGAAATAGCGCAGCAACAGGCTGGTATGGAGCCAACACAGATCCCAGATACTCAACAATTTCTAGATTCATGGGACCGTCTACAGGGATGAACATGGCAGGCATGGGCACTTTGCAGGGCATAGCAGAAGCTGCCAAGTCTATGACTCCTCTCCATGCTGCTCCCAGAAGGAAAAGGAGAGTGCTCTTCTCTCAAGCGCAAGTTTATGAGTTGGAGAGGAGGTTCAAGCAGCAGAAGTATCTGTCAGCCCCCGAGAGAGAACACCTGGCCAGCATGATCCACCTCACTCCTACCCAGGTCAAGATCTGGTTCCAGAATCACAGGTACAAGATGAAGAGACAAGCCAAGGACAAGGTCACTCAACAGCTACAACAGGACAACAATTTGTGTCAACAGCAATCCCCCCGTAGAGTTGCTGTGCCAGTCTTGGTGAAAGATGGCAAGCCTTGTCAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)