Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:7202413.3                       4 END     1          25       25                MGC86262 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7202413.5                       4 PI      91       1168     1452                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012791625 Xl3.1-IMAGE:5505982.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5505982.5 CGCTGCAATGGACAACTTCACAGGAGCCCACTGACGAGGTGTCATTCATTGGCTCACAGGGGGAAGCGTCGTATCCATCCCCGAGGCGCAACTCTTGGCGTTACTGGCTGCGGCTGTCACTCAGTCGGGATAGACGGCCAGTAGCTAGAGCTAGTGTGACAGCCACAAGATCAATGATGGCACAAAACATGTATGATATTGATGATGCTCATTTGGAAACATTTTTACGTATAAACCCTTTATTTCAAGAACCTATGTATATGCCTTCTGAGCCACACCTTCGAAATGCTGAAGGGCCATACATTGAAATTACAGAACAACCAAAACAGAGAGGGTTTCGGTTTCGATATGTCTGTGAAGGGCCATCACATGGAGGACTTCCTGGGGCTTCAAGTGAAAAAAACAGAAAGTCATACCCACAAATTAAGATTCATAATTATGTTGGTCAAGTTAAGGTTGTAGTGCAGCTGATAACTAACAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGATGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGGTTTCCTAACCTGGGAATACTTCATGTTACGAAGAAGAAAGTGATTGAGATTCTAGAGGCTCGCATGACAGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACACCCAGAGCTCAACTATACCAACTCTGAAGATAGGCCATTAAATGAGCGAGAAAAGGAAATCATTAGACAGGCCGCAACGCAACAGTCCAAGGATATCGACCTGAGTGTGGTGCGACTCATGTTCACTGCTTTCCTGCTAGATAGCGAAGGTCGATTTACTAGATCTCTTGAGCCTGTATTATCAGTTCCCATCTTTGATAGCAAAGCCCCCAATGCATCCAATCTTAAAATTGTGCGAATGGACAGGACTGCAGGCTGTGTGACAGGTGGGGAAGAGGTATATCTCCTGTGTGATAAAGTACAAAAAGATGACATTCAAGTCCGCTTCTATGAAGAGGATGAAAATGGAGGCTACTGGGAAGGATTTGGAGACTTCTCTCCTACTGATGTTCATAGACAGTTTGCCATTGTTTTCAAAACGCCCAAGTACAAGGATGTAAATATTACAAAGGCAGCGTCTGTGTTTGTTCAGCTTCGGAGGAAATCAGATTATGAAACTAGTGAACCTAAACCATTTCTTTACTACCCAGAAATAAAAGACAAAGAGGAAGTACAAAGGAAACGCCAGAAGCTCATGCCTAATTTTTCAGACGGTTATGGTGGAAGTGGTGCAGGATCTGGTGGAAGGTGTGGTGGTGGTTTATTATATGGGAAGGAAGGAGGAACAGAAGCTCCTGCAGGTGGTGGGCTATGGGTTTTCTTCATTCAGCTATAATAATTTATGAAGGGTTGAATTTTTCTTGGAAGGCCCTATGAAATTCTGG
                                                  Xl3.1-CHK-1012709664       AATGGACAACTTCACAGGAGCCCACTGACGAGGTGTCATTCATTGGCTCACAGGGGGAAGCGTCGTATCCATCCCCGAGGCGCAACTCTTGGCGTTACTGGCTGCGGCTGTCACTCAGTCGGGATAGACGGCCAGTAGCTAGAGCTAGTGTGACAGCCACAAGATCAATGATGGCACAAAACATGTATGATATTGATGATGCTCATTTGGAAACATTTTTACGTATAAACCCTTTATTTCAAGAACCTATGTATATGCCTTCTGAGCCACACCTTCGAAATGCTGAAGGGCCATACATTGAAATTACAGAACAACCAAAACAGAGAGGGTTTCGGTTTCGATATGTCTGTGAAGGGCCATCACATGGAGGACTTCCTGGGGCTTCAAGTGAAAAAAACAGAAAGTCATACCCACAAATTAAGATTCATAATTATGTTGGTCAAGTTAAGGTTGTAGTGCAGCTGATAACTAACAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGATGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGGTTTCCTAACCTGGGAATACTTCATGTTACGAAGAAGAAAGTGATTGAGATTCTAGAGGCTCGCATGACAGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACACCCAGAGCTCAACTATACCAACTCTGAAGATAGGCCATTAAATGAGCGAGAAAAGGAAATCATTAGACAGGCCGCAACGCAACAGTCCAAGGATATCGACCTGAGTGTGGTGCGACTCATGTTCACTGCTTTCCTGCTAGATAGCGAAGGTCGATTTACTAGATCTCTTGAGCCTGTATTATCAGTTCCCATCTTTGATAGCAAAGCCCCCAATGCATCCAATCTTAAAATTGTGCGAATGGACAGGACTGCAGGCTGTGTGACAGGTGGGGAAGAGGTATATCTCCTGTGTGATAAAGTACAAAAAGATGACATTCAAGTCCGCTTCTATGAAGAGGATGAAAATGGAGGCTACTGGGAAGGATTTGGAGACTTCTCTCCTACTGATGTTCATAGACAGTTTGCCATTGTTTTCAAAACGCCCAAGTACAAGGATGTAAATATTACAAAGGCAGCGTCTGTGTTTGTTCAGCTTCGGAGGAAATCAGATTATGAAACTAGTGAACCTAAACCATTTCTTTACTACCCAGAAATAAAAGACAAAGAGGAAGTACAAAGGAAACGCCAGAAGCTCATGCCTAATTTTTCAGACGGTTATGGTGGAAGTGGTGCAGGATCTGGTGGAAGGTGTGGTGGTGGTxTxTTATATGGGAAGGAAGGAGGAACAGAAGCTCCTGCAGGTGGTGGGCTATGGGTTTTCTTCATTCAGCTATAATAATTTATGAAGGGTTGAATTTTTCTTGGAAGGCCCTATGAAATTCTGGTCCATG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     173     195 
                                               BLH MIN     176     176 
                                               BLH MPR     119     176 
                                               BLH OVR     173     225 
                                               CDS MIN     173     176 
                                               ORF LNG     173      19 
  5   1   1       add Brn1 5g                         IMAGE:7018790.5p CGCTGCAATGGACAACTTCACAGGAGCCCACTGACGAGGTGTCATTCATTGGCTCACAGGGGGAAGCGTCGTATCCATCCCCGAGGCGCAACTCTTGGCGTTACTGGCTGCGGCTGTCACTCAGTCGGGATAGACGGCCAGTAGCTAGAGCTAGTGTGACAGCCACAAGATCAATGATGGCACAAAACATGTATGATATTGATGATGCTCATTTGGAAACATTTTTACGTATAAACCCTTTATTTCAAGAACCTATGTATATGCCTTCTGAGCCACACCTTCGAAATGCTGAAGGGCCATACATTGAAATTACAGAACAACCAAAACAGAGAGGGTTTCGGTTTCGATATGTCTGTGAAGGGCCATCACATGGAGGACTTCCTGGGGCTTCAAGTGAAAAAAACAGAAAGTCATACCCACAAATTAAGATTCATAATTATGTTGGTCAAGTTAAGGTTGTAGTGCAGCTGATAACTAACAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGATGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGGTTTCCTAACCTGGGAATACTTCATGTTACGAAGAAGAAAGTGATTGAGATTCTAGAGGCTCGCATGACAGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACACCCAGAGCTCAACTATACCAACTCTGAAGATAGGCCATTAAATGAGCGAGAAAAAGAAATCATTAGACAGGGCCGCAACGCAACAGTCCAAGGGATATCNNGACCTGAGTGTGGGTGCCGACTTCATGTTTCACTGGCTTTTTCCTGCC
  5   1   2      seed Sp1                             IMAGE:5505982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTCGCATGACAGACGCTTTCAAAAAGGGACACAATGCTGCATTATTAGTACACCCAGAGCTCAACTATACCAACTCTGAAGATAGGCCATTAAATGAGCGAGAAAAGGAAATCATTAGACAGGCCGCAACGCAACAGTCCAAGGATATCGACCTGAGTGTGGTGCGACTCATGTTCACTGCTTTCCTGCTAGATAGCGAAGGTCGATTTACTAGATCTCTTGAGCCTGTATTATCAGTTCCCATCTTTGATAGCAAAGCCCCCAATGCATCCAATCTTAAAATTGTGCGAATGGACAGGACTGCAGGCTGTGTGACAGGTGGGGAAGAGGTATATCTCCTGTGTGATAAAGTACAAAAAGATGACATTCAAGTCCGCTTCTATGAAGAGGATGAAAATGGAGGCTACTGGGAAGGATTTGGAGACTTCTCTCCTACTGATGTTCATAGACAGTTTGCCATTGTTTTCAAAACGCCCAAGTACAAGGATGTAAATATTACAAAGGCAGCGTCTGTGTTTGTTCAGCTTCGGAGGAAATCAGATTATGAAACTAGTGAACCTAAACCATTTCTTTACTACCCAGAAATAAAAGACAAAGAGGAAGTACANAGGAAACGCCAGAAGCTCATGCCTAATTTTTCAGACggttatggtggaagtggtgcaggatctggtggaaggtgtggtggtggtTTATATGGAGGAGGAGGAGCAAGGAGCTCTGCANGTGGTGGCTAATGGTTTN
  5   1   2       bld Tad1                            IMAGE:6879740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACACCCAGAGCTCAACTATACCAACTCTGAAGATAGGCCATTAAATGAGCGAGAAAAGGAAATCATTAGACAGGCCGCAACGCAACAGTCCAAGGATATCGACCTGAGTGTGGTGCGACTCATGTTCACTGCTTTCCTGCTAGATAGCGAAGGTCGATTTACTAGATCTCTTGAGCCTGTATTATCAGTTCCCATCTTTGATAGCAAAGCCCCCAATGCATCCAATCTTAAAATTGTGCGAATGGACAGGACTGCAGGCTGTGTGACAGGTGGGGAAGAGGTATATCTCCTGTGTGATAAAGTACAAAAAGATGACATTCAAGTCCGCTTCTATGAAGAGGATGAAAATGGAGGCTACTGGGAAGGATTTGGAGACTTCTCTCCTACTGATGTTCATAGACAGTTTGCCATTGTTTTCAAAACGCCCAAGTACAAGGATGTAAATATTACAAAGGCAGCGTCTGTGTTTGTTCAGCTTCGGAGGAAATCAGATTATGAAACTAGTGAACCTAAACCATTTCTTTACTACCCAGAAATAAAAGACAAAGAGGAAGTACAAAGGAAACGCCAGAAGCTCATGCCTAATTTTTCAGACGGTTATGGTGGAAGTGGTGCAGGATCTGGTGGNAGNTGTTTGNTGGGTGTTTTATATGGGAAGGAAGGAGGAACAGAAGCTCCTGCAGGTGGTGGGCTATGGGTTTTCTTCATTCAGCTATAATAATTTATGAAGGGTTGAATTTTTCTTGGAAGGCCCTATGAAATTCTGGTCCATGG
  5   1   1       add Ooc2      out                   IMAGE:3745886.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAATTCCCACCTACTGATGTCCATAGACAGTATGCCATTGTCTTCAAAACTCCCAAGTATAAGGATGTAAATATTACAAAGGCAGCATCTGTTTTTGTTCAGCTTCGGAGGAAATCAGATTATGAAACTAGTGAACCCAAACCATTTCTTTACTACCCTGAAATAAAAGACAAGGAAGAAGTACAAAGGAAACGCCAGAAGCTTATGCCTAATTTCTCAGACGGTTATGGTGGAAGTGGGACAGGATCTGGTGGAGGTGGTGGTGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)