Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 87%

 1012791725 Xl3.1-IMAGE:5157255.5 - 3 ESTs
                                                                       ....-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5157255.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTACGCCGAGGACGCAGGAAAGCGTCGCCATCTTCAGTACTGGCATTTTTTTTTTTTTAAATTTTTATTTGAGTTCTGAAATGCAAACCTCTTTAAGGCTGCGCCATGTCTAGAGTTTGTTACAAAAGCCGGACTCTAGTTAATGGTTTATGAAATTTACTGTAGATTAACATGACAGCATTTTACTTTCACTTGAAGTGACTGGTGGCACTTGTAACTTACTGTTCTGAGGATCCTACATGGATAGATCTAAAATCCCAACTGTGCCCCTGTCTAGTGGGCATCACATTCCTCTGCTGGGTCTGGGAATGTCTCATAGTGGAGGGTATTCCCACAATGCACTGCTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATATGGGAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTTACCACCAAACTGTGGCCAGGAGACTATGGGTATGAGAATGCAATACAATCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTTATGCATTGGCCTGATGCTCATGTACCAGGTAAGAGTGCCAGGGAAGCAAGAGCAGAGACTTGGCAAGCACTGGAGGAGCTGCACGAAAAAGGAATTTGTCGCTCTATTGGTGTTAGTAACTTTCTAATCCATCACTTGGATCAACTGAAGGAAGACTGCAATGTTGTACCTCACCTTAACCAGGTTGAGTATCATCCATTTCAAAAACCACAGGAACTTGGTTGATTATTTGTAGAAGGAATTAATATTGGTATTTTGGGGGGATACTGTCCCCCTGGNCCAAAAAGAACAAAGCCCCTTGAAATCACCCCTTACAATTTCCAGAAAAATTGCG
                                                  Xl3.1-CHK-1012713730                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAGGACGCAGGAAAGCGTCGCCATCTTCAGTACTGGCATTTTTTTTTTTTTAAATTTTTATTTGAGTTCTGAAATGCAAACCTCTTTAAGGCTGCGCCATGTCTAGAGTTTGTTACAAAAGCCGGACTCTAGTTAATGGTTTATGAAATTTACTGTAGATTAACATGACAGCATTTTACTTTCACTTGAAGTGACTGGTGGCACTTGTAACTTACTGTTCTGAGGATCCTACATGGATAGATCTAAAATCCCAACTGTGCCCCTGTCTAGTGGGCATCACATTCCTCTGCTGGGTCTGGGAATGTCTCATAGTGGAGGGTATTCCCACAATGCACTGCTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATATGGGAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTTACCACCAAACTGTGGCCAGGAGACTATGGGTATGAGAATGCAATACAATCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTTATGCATTGGCCTGATGCTCATGTACCAGGTAAGAGTGCCAGGGAAGCAAGAGCAGAGACTTGGCAAGCACTGGAGGAGCTGCACGAAAAAGGAATTTGTCGCTCTATTGGTGTTAGTAACTTTCTAATCCATCACTTGGATCAACTGAAGGAAGACTGCAATGTTGTACCTCACCTTAACCAGGTTGAGTATCATCCATTTCAAAAACCACAGGAACTTGGTTGATTATTTGTAGAAGGAATTAATATTGGTATTTTGGGGGGATACTGTCCCCCTGGNCCAAAAAGAACAAAGCCCCTTGAAATCACCCCTTACAATTTCCAGAAAAATTGCGAAAAGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     239      88                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN     230      68                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR     239     278                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG     239       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                       PROTEIN --- Ci ---- 1e-019     NP_001027833.1 aldo-keto reductase 1a [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ==== 9e-025     NP_697021.1 aldo-keto reductase family 1, member A1; aldehyde reductase; alcoholdehydrogenase [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 7e-025     XP_001202238.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Mm ==== 3e-025     XP_001472913.1 PREDICTED: similar to aldehyde reductase [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Cf ==== 2e-025     XP_853157.1 PREDICTED: similar to Alcohol dehydrogenase [NADP+] (Aldehyde reductase) (Aldo-keto reductase family 1 member A1) [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Gg ---- 1e-025     NP_001006539.1 similar to Alcohol dehydrogenase [NADP+] (Aldehyde reductase) (Aldo-keto reductase family 1 member A1) [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bt ---- 1e-025     NP_001069981.1 aldo-keto reductase family 1, member A1 (aldehyde reductase) [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Os ---- 3e-027     NP_001055826.1 Os05g0474600 [Oryza sativa (japonica cultivar-group)] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- At ---- 3e-027     NP_201048.1 aldo/keto reductase family protein [Arabidopsis thaliana] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dm ==== 1e-028     NP_647840.1 CG10863-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 3e-035     XP_640006.1 aldo-keto reductase [Dictyostelium discoideum AX4] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Ce ==== 9e-042     NP_495578.2 ZK1290.5 [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 1e-073     NP_001017779.1 hypothetical protein LOC550476 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 6e-103     AAH89068.1 Unknown (protein for IMAGE:7004153) [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 9e-110     NP_001086970.1 MGC80525 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5157255.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------TAG---------------------------TAA------ATG---------------TAA---------------------------------------------------------TGA---------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2      seed Emb1 5g                         IMAGE:5157255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTACGCCGAGGACGCAGGAAAGCGTCGCCATCTTCAGTACTGGCAtttttttttttttAAATTTTTATTTGAGTTCTGAAATGCAAACCTCTTTAAGGCTGCGCCATGTCTAGAGTTTGTTACAAAAGCCGGACTCTAGTTAATGGTTTATGAAATTTACTGTAGATTAACATGACAGCATTTTACTTTCACTTGAAGTGACTGGTGGCACTTGTAACTTACTGTTCTGAGGATCCTACATGGATAGATCTAAAATCCCAACTGTGCCCCTGTCTAGTGGGCATCACATTCCTCTGCTGGGTCTGGGAATGTCTCATAGTGGAGGGTATTCCCACAATGCACTGCTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATATGGGAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTTACCACCAAACTGTGGCCAGGAGACTATGGGTATGAGAATGCAATACAATCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTTATGCATTGGCCTGATGCTCATGTACCAGGTAAGAGTGCCAGGGAAGCAAGAGCAGAGACTTGGCAAGCACTGGAGGAGCTGCACGAAAAAGGAATTTGTCGCTCTATTGGTGTTAGTAACTTTCTAATCCATCACTTGGATCAACTGAAGGAAGACTGCAATGTTGTACCTCACCTTAACCAGGTTGAGTATCATCCATTTCAAAAACCACAGGAACTTGGTTGATTATTTGTAGAAGGAATTAATATTGGTATTTTGGGGGGATACTGTCCCCCTGGNCCAAAAAGAACAAAGCCCCTTGAAATCACCCCTTACAATTTCCAGAAAAATTGCGAAAAGC
  5   1   2       bld DMZ  5x3  out                        xl298k12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAACCTCTTTAAGGCTGCGCCATGTCTAGAGTTTGTTACAAAAGCCGGACTCTAGTTAATGGTTTATAAAATTTACTGTAGATTAACATGACAGCATTTTACTTTCACTTGAATTGACTGGTGGCACTTGTAACTTACTGTTCTGAGGATCCTACATGGATAGATCTAAAATCCCAACTGTGCCCCTGTCTAGTGGGCATCACATTCCTCTGCTGGGTCTGGGAATGTCTCATAGTGGAGGGTATTCCCACAATGCACTGCTCTATGCTTTGACAACATGTGGCATCCGCCATATTGACACAGCCAAGAGATATGGGAATGAAGTTATGGTGGGGAAAGCAATATGTGAAAGTGGAGTGAAGAGAGAAGAGCTGTGGCTTACCACCAAACTGTGGCCAGGAGACTATGGGTATGAGAATGCAATACAATCATGTCTGGATTCATGCAAGAGACTAGGAGTAGACTATCTAGACTTGTACCTTATGCATTGGCCTGATGCTCATGTACCAGGTAAGAGTGCCAGGGAAGCAAGAGCAGAGACTTGGCAAGCACTGGAGGAGCTGCACGAAAAAGGAATTTGTCGCTCTATTGGTGTTAGTAACTTTCTAATCCATCACTTGGATCAACTGAA
  5   1   1       add Egg1                               PBX0059A09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGAGGCAAAAGCCGGACTCTAGTTAATGGTTTATGAAATTTACTGTAGATTAACATGACAGCATTTTACTTTCACTTGAAGTGACTGGTGGCACTTGTAACTTACTGTTCTGAGGATCCTACATGGATAGATCTAAAATCCCAACTGTGCCCCTGTCTAGTGGGCATCACATTCCTCTGCTGGGTCTGGACTTGTACCTTATGCATTGGCCTGATGCTCATGTACCAGGTAAGAGTGCCAGGGAAGCAAGAGCAGAGACTTGGCAAGCACTGGAGGAGCTGCACGAAAAAGGAATTTGTCGCTCTATTGGTGTTAGTAACTTTCTAATCCATCACTTGGATCAACTGAAGGAAGACTGCAATGTTGTACCTCACCTTAACCAGGTTGAGTATCATCCATTTCAAAAACCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)