Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 66%

 1012791863 Xl3.1-IMAGE:5513210.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5513210.5 AAAAANCCACTG------------ATCCATCGATTCGAATTCGTCCCAGGGAACCAAGTGCAAAGAAAAAGTTTGACAGGCAAAGCAGCCTCAAGAGGCTAGGGGACATGCAACAAGAGTCTGACAGAAATGAGCAGGGCTACAGCAGCTCCCCCCCTTCTAGCAATAAACAGGACTCTTCAGATGACACAAAGAAAAATCACAGAAGAGAGAAAAATAGGATTGCAGCACAGAAAAGCCGCCAGCGACAAACAGAAAAAGCAGACTCGTTGCACATTGAGAGTGAGAATTTGGAGCGCCTGAATTCGGCATTACGCGGAGAAATCAGTGGCCTGCGAGAGGAACTGAAATATCTCACATGTGTGCTAAGTACCCACCAACCTGTTTGTGTCCTTGGTCCAACAAAGCCACAAGCTATCCTCCCACATGTCGGATCCACCCGCTACCAGCACTAAGGGTACATGGACGGTGATTACACATTCATGTTGTATCATAGTGCAAACAAGAACTATGACATTCGTAATATACTCTTGGGCTCATCATGACATGTTCAGCTTTAGGTGAAAATAAAATGTTGATCTCTAAAGAGATGATAGAATGTGCAAGGGCATGTGTTATGCCTGTTGTAAAATGCCTGAATGTGCTAAAAAACACATAAATATCACGTGTTGGGCAATGACACACATTATATAAGAATTTGTATAGATGCGCAATGTCATAAAATACAAGTGTGTGTGTGTGTGTCTGTGACTATCATAAATACAGAAGCATACACATGTATATCTGATATATAACGCTGAAAATATATGTGCTGTCTGTAAGGGAGACTGCTTGTGATAATGATACTCAATC
                                                  Xl3.1-CHK-1012707854       CCACTGGTTGCN------------CGATTCGAATTCxxCxCxxxxxACCAAGTGCAAAGAAAAAGTTTGACAGGCAAAGCAGCCTCAAGAGGCTAGGGGACATGCAACAAGAGTCTGACAGAAATGAGCAGGGCTACAGCAGCTCCCCCCCTTCTAGCAATAAACAGGACTCTTCAGATGACACAAAGAAAAATCACAGAAGAGAGAAAAATAGGATTGCAGCACAGAAAAGCCGCCAGCGACAAACAGAAAAAGCAGACTCGTTGCACATTGAGAGTGAGAATTTGGAGCGCCTGAATTCGGCATTACGCGGAGAAATCAGTGGCCTGCGAGAGGAACTGAAATATCTCACATGTGTGCTAAGTACCCACCAACCTGTTTGTGTCCTTGGTCCAACAAAGCCACAAGCTATCCTCCCACATGTCGGATCCACCCGCTACCAGCACTAAGGGTACATGGACGGTGATTACACATTCATGTTGTATCATAGTGCAAACAAGAACTATGACATTCGTAATATACTCTTGGGCTCATCATGACATGTTCAGCTTTAGGTGAAAATAAAATGTTGATCTCTAAAGAGATGATAGAATGTGCAAGGGCATGTGTTATGCCTGTTGTAAAATGCCTGAATGTGCTAAAAAACACATAAATATCACGTGTTGGGCAATGACACACATTATATAAGAATTTGTATAGATGCGCAATGTCATAAAATACAAGTGTGTGTGTGTGTGTCTGTGACTATCATAAATACAGAAGCATACACATGTATATCTGATAxxxAACGCTxxxxxxATATGTxxTxTxTGTAAGGxxxACTGCTTGTGATAATGATAC
                                                      consensus depths      1     1     0     1     1     2     1     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     1     4     1     4     1     4     1     4     1     4     1     4     2     4     1     4     1     3     1     3     1     3     1     3     1     3     1     2     1     2     1     1
                                               BLH ATG     118     128 
                                               BLH MIN      22      29 
  5   1   2       add Spl  5x3                        IMAGE:8462857.5p AAAAANCCACTGGTTGCNNNGAAGATCCATCGATTCGAATTCGTCCCAGGGAACCAAGTGGCAAGAAAAAGTTTGACAGGCAAAGCAGCCTCAAGAGGCTAGGGGACATGCAACAAGAGTCTGACAGAAATGAGCAGGGCTACAGCAGCTCCCCCCCTTCTAGCAATAAACAGGACTCTTCAGATGACACAAAGAAAAATCACAGAAGAGAGAAAAATAGGATTGCAGCACAGAAAAGCCGCCAGCGACAAACAGAAAAAGCAGACTCATTGCACATTGAGAGTGAGAATTTGGAGCGCCTGAATTCGGCATTACGCGGAGAAATCAGTGGCCTGCGAGAGGAACTGAAATATCTCACATGTGTGCTAAGTACCCACCAACCTGTTTGTGTCCTTGGTCCAACAAAGCCACAAGCTATCCTCCCACATGTCGGATCCACCCGCTACCAGCACTAAGGGTACATGGACGGTGATTACACATTCATGTTGTATCATAGTGCAAACAAGAACTATGACATTCGTAATATACTCTTGGGCTCATCATGACATGTTCAGCTTTAGGTGAAAATAAAATGTTGATCTCTAAAGAGATGATAGAATGTGCAAGGGCATGTGTTATGCCTGTTGTAAAATGCCTGAATGTGCTAAAAAACCCATAATATCACGTGTTGGGCATGACACCATTATATTAGAATTTGTATTAGTGCGCAAATGCATAAAATACAAGTGTGTGGGGTGGTCTGTGACTATTCTAAATACAGAAAGCTAACACTTGTATTCTGAGTATATAAGCAACGCTGAAAATTGAGCTTTTCTTTGTAAGGGAGACTGCGTGGGAATTATGA
  5   1   2      seed Spl  5x3                        IMAGE:8460158.5p                    CACTGACAAGGCCCTGAGAAACGGGGAAAGGAAACCAAGTGCAAAGAAAAAGTTTGACAGGCAAAGCAGCCTCAAGAGGCTAGGGGACATGCAACAAGAGTCTGACAGAAATGAGCAGGGCTACAGCAGcccccccccTTCTAGCAATAAACAGGACTCTTCAGATGACACAAAGAAAAATCACAGAAGAGAGAAAAATAGGATTGCAGCACAGAAAAGCCGCCAGCGACAAACAGAAAAAGCAGACTCGTTGCACATTGAGAGTGAGAATTTGGAGCGCCTGAATTCGGCATTACGCGGAGAAATCAGTGGCCTGCGAGAGGAACTGAAATATCTCACATGTGTGCTAAGTACCCACCAACCTGTTTGTGTCCTTGGTCCAACAAAGCCACAAGCTATCCTCCCACATGTCGGATCCACCCGCTACCAGCACTAAGGGTACATGGACGGTGATTACACATTCATGTTGTATCATAGTGCAAACAAGAACTATGACATTCGTAATATACTCTTGGGCTCATCATGACATGTTCAGCTTTAGGTGAAAATAAAATGTTGATCTCTAAAGAGATGATAGAATGTGCAAGGGCATGTGTTATGCCTGTTGTAAAATGCCTGAATGTGCTAAAAAACACATAAATATCACGTGTTGGGCAATGACACACATTATATAAGAATTTGTATAGATGCGCAATGTCATAAAATACAAgtgtgtgtgtgtgtgtCTGTGACTATCATAAATACAGAAGCATACACATGTATATCTGATATATANGCACACTGCAATATGTGCTGTCNTGTAAGTCAACTGCTTGTGATAATGATACTCAATCGTAGG
  5   1   2       bld Sp1  5x3                        IMAGE:5513210.5p                                         CCCACGCGTCCGACCAAGTGCAAAGAAAAAGTTTGACAGGCAAAGCAGCCTCAAGAGGCTAGGGGACATGCAACAAGAGTCTGACAGAAATGAGCAGGGCTACAGCAGCTCCCCCCCTTCTAGCAATAAACAGGACTCTTCAGATGACACAAAGAAAAATCACAGAAGAGAGAAAAATAGGATTGCAGCACAGAAAAGCCGCCAGCGACAAACAGAAAAAGCAGACTCGTTGCACATTGAGAGTGAGAATTTGGAGCGCCTGAATTCGGCATTACGCGGAGAAATCAGTGGCCTGCGAGAGGAACTGAAATATCTCACATGTGTGCTAAGTACCCACCAACCTGTTTGTGTCCTTGGTCCAACAAAGCCACAAGCTATCCTCCCACATGTCGGATCCACCCGCTACCAGCACTAAGGGTACATGGACGGTGATTACACATTCATGTTGTATCATAGTGCAAACAAGAACTATGACATTCGTAATATACTCTTGGGCTCATCATGACATGTTCAGCTTTAGGTGAAAATAAAATGTTGATCTCTAAAGAGATGATAGAATGTGCAAGGGCATGTGTTATGCCTGTTGTAAAATGCCTGAATGTGCTAAAAAAACACATAAATATCACGTGTTGGGCAATGACACACATTATATAAGAAATTTGTATTAGATGCGCANATGTCATAAAAATACAAAgtgtgtgtggtgtgtgtctgtgACCTATTCATAAAATACAGGAAAGCANTACACATTGTATATCTGAGTATTATANGGCACN
  5   1   2       bld Emb4 5x3                        IMAGE:5515203.5p                                         CCCACGCGTCCGACCATTTGCAAAGAAAAAGTTTGACAGGCAAAGCAGCCTCAAGAGGCTAGGGGACATGCAACAAGAGTCTGACAGAAATGAGCAGGGCTACAGCAGCTCCCCCCCTTCTAGCAATAAACAGGACTCTTCAGATGACACAAAGAAAAATCACAGAAGAGAGAAAAATAGGATTGCAGCACAGAAAAGCCGCCAGCGACAAACAGAAAAAGCAGACTCGTTGCACATTGAGAGTGAGAATTTGGAGCGCCTGAATTCGGCATTACGCGGAGAAATCAGTGGCCTGCGAGAGGAACTGAAATATCTCACATGTGTGCTAAGTACCCACCAACCTGTTTGTGTCCTTGGTCCTACAAAGCCACAAGCTATCCTCCCACATGTCGGATCCACCCGCTACCAACACTAATGGTACTTGGACGGGGATTACCACAATTCATGCACACCATAGTGCATAAATAATATGACATTTGCGAAATATCCAGTGCTCTTTTTGAAAGATGTGTCTAATGAGAAAATAATGGGTGATCTCAAGGAAAAGAATAAATCAATTGGCATGCTTACGCCAGTTGTAAACTGACCAACGAACATACAACGAGAGAGAATACTGTGGGGAAGGAACAAAGTAAAAGAGGTGTTAAAATGCCAAGGTCAATAATAGACGTGGCGTGTTTGGTTATACAATCAAAAACAGAAGTACAATATTAAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)