Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL001i24.3                           11 END     1          20        9                axin-related protein [Xenopus laevis]
     2   1.0    0Xl3.1-IMAGE:8463866.3                       7 END     1          20       14                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012792019 Xl3.1-IMAGE:6863285.5 - 5 ESTs
                                                                       .....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6863285.5                GGTGTGAGCTGATTCCCCTTCTCTCTCCTCTTTTATACATTTTGTTCTCCCTTCTCCGCTGTGGATTTACTTTCTGCCTCCGCTTGGATTTATTAAAGGGCAGCGATGAGAGCCGATCACATGGGATTATTATTATTACTGGACTTTTAGCGCAAAGGAGCCGCCGCTGTCGCATAAACGAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTACTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGCCCGAAAAGTTCACCATGGATTCTCAGCACTTAAAACACAAGGAAGATTTTATCCGTGAAGCTGAAGGCTGCGTTGCCCATGATTCCCGCTTTTCCAGATGGGGCAGGTCTCTAAATCTTCTGCTGGACGACCAGGATGGAGCAACACTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGGGGATCTTTTAAGTTTCTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCATCGGAACCCAAGACATCGAAAACAGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCCGTTTTATGCCGCTTAAAGCCATCCACCCGCACCCAAGTGAAGGAGTGTGTGAAGAACCAACAATTGAACAAGACTGTGTTTGACCAGGCCCAGCAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCCTTTTTGCAGTCTGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGACAGTCCTGGGCCAGGGCTTCCAACATTGGCTGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATTGGGAAAATAAATCGTGCCTTAGGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGAAAATCGGAACCAACCTATCCGTACTTTGCTCCTGCAGCCAGTATCAACGACAGTGAGATATCCAGCGATGCTTTGACAGAAGACAGTATGTCCATGACAGATGCGAGTGTAGATGGAATTCCGCCATATCGCTCAAAAAAGCAGAGGGAGATCCACCG
                                                  Xl3.1-CHK-1012705821                      AGCTGATTCCCCTTCTCTCTCCTCTTTTATACATTTTGTTCTCCCTTCTCCGCTGTGGATTTACTTTCTGCCTCCGCTTGGATTTATTAAAGGGCAGCGATGAGAGCCGATCACATGGGATTATTATTATTACTGGACTTTTAGCGCAAAGGAGCCGCCGCTGTCGCATAAACGAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTACTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGCCCGAAAAGTTCACCATGGATTCTCAGCACTTAAAACACAAGGAAGATTTTATCCGTGAAGCTGAAGGCTGCGTTGCCCATGATTCCCGCTTTTCCAGATGGGGCAGGTCTCTAAATCTTCTGCTGGACGACCAGGATGGAGCAACACTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGGGGATCTTTTAAGTTTCTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCATCGGAACCCAAGACATCGAAAACAGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCCGTTTTATGCCGCTTAAAGCCATCCACCCGCACCCAAGTGAAGGAGTGTGTGAAGAACCAACAATTGAACAAGACTGTGTTTGACCAGGCCCAGCAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCCTTTTTGCAGTCTGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGACAGTCCTGGGCCAGGGCTTCCAACATTGGCTGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATTGGGAAAATAAATCGTGCCTTAGGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGAAAATCGGAACCAACCTATCCGTACTTTGCTCCTGCAGCCAGTATCAACGACAGTGAGATATCCAGCGATGCTTTGACAGAAGACAGTATGTCCATGACAGATGCGAGTGTAGATGGAATTCCGCCATATCGCTCAAAAAAGCAGAGGGAGATCCACCGGAGCGT
                                                      consensus depths                     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     2     2     3     3     3     3     3     3     3     3     2     3     2     3     1     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     208     190                
                                               BLH MIN     208      90                
                                               BLH MPR     190      90                
                                               BLH OVR     208     249                
                                               CDS MIN     208      90                
                                               ORF LNG     208      12                
                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 3e-009     NP_001123154.1 Regulator of G protein Signaling family member (rgs-7) [Caenorhabditis elegans] ------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 9e-012     NP_733338.1 Axin CG7926-PC [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                         PROTEIN --- Ag ---- 5e-017     XP_320914.3 AGAP002123-PA [Anopheles gambiae str. PEST] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 3e-031     XP_001178295.1 PREDICTED: similar to axin [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ---- 1e-048     XP_871703.2 PREDICTED: similar to axin 1 isoform 2 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dr ---- 4e-060     NP_571636.1 axin 2 (conductin, axil) [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PREDICTED = Cf ==== 8e-063     XP_548025.2 PREDICTED: similar to Axin 2 (Axis inhibition protein 2) (Conductin) (Axin-like protein) (Axil) isoform 1 [Canis familiaris] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PREDICTED = Bt ==== 2e-063     XP_588992.3 PREDICTED: similar to conductin [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 2e-063     NP_056547.3 axin2 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 3e-064     NP_004646.2 axin 2 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 8e-065     NP_989822.1 axin-related protein [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 3e-166     CAL49410.1 axin 2 (conductin, axil) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 3e-175     NP_001087841.1 MGC81576 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6863285.5                    TGA---------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------TAA---------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG
                                                                   ORF                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2      seed Emb1 5g                         IMAGE:6863285.5p CTTACTCAACAACAAGGTGTGAGCTGATTCCCCTTCTCTCTCCTCTTTTATACATTTTGTTCTCCCTTCTCCGCTGTGGATTTACTTTCTGCCTCCGCTTGGATTTATTAAAGGGCAGCGATGAGAGCCGATCACATGGGATTATTATTATTACTGGACTTTTAGCGCAAAGGAGCCGCCGCTGTCGCATAAACGAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTACTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGCCCGAAAAGTTCACCATGGATTCTCAGCACTTAAAACACAAGGAAGATTTTATCCGTGAAGCTGAAGGCTGCGTTGCCCATGATTCCCGCTTTTCCAGATGGGGCAGGTCTCTAAATCTTCTGCTGGACGACCAGGATGGAGCAACACTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGGGGATCTTTTAAGTTTCTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCATCGGAACCCAAGACATCGAAAACAGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTCAGCCGTTTTATGCCGCTTAAAGCCATCCACCCGCACCCAAGTGAAGGAGTGTGTGAAGAACCAACAATTGAACAAGACTGTGTTTGACCAGGCCCAGCAAGAGATACAAAGGGCAATGGAGCAGGAGGCATTTACCTCCTTTTTGCAGTCTGATATATGCAAGGAGTATGCTCCTGGTGTTGAAGAACAGTCCAACTCCAGACAGTCCTGGGCCAAGGGCTTCCAACATTGGGCTGAAGGATGAGGAAGTTTG
  5   1   2       bld Neu7 5g3  out                        XL005a06.5p                GGTGTGAGCTGATTCCTCTTCTCTCTCCTCTTTTATACATTTTGTTCTCCCTTCTCCGCTGTGGATTTACTTTCTGCCTCCGCTTGGATTTATTAAAGGGCAGCGATGAGAGCCGATCACATGGGATTATTATTATTACTGGACTTTTAGCGCAAAGGAGCCGCCGCTGTCGCATAAACGAGGATATTTGTAAAGACTCCTGGCAGCCATGAGTTCTGCTGGAGTACTGACCTGCATCCCAGACTCTGGACGTATCTTCAGGGAAACTTCTTTGCGTCCACCTGTACCAGGCCAGGAGACTAAAAACTACAAGCCCGAAAAGTTCACCATGGATTCTCAGCACTTAAAACACAAGGAAGATTTTATCCGTGAAGCTGAAGGCTGCGTTGCCCATGATTCCCGCTTTTCCAGATGGGGCAGGTCTCTAAATCTTCTGCTGGACGACCAGGATGGAGCAACACTTTTCCGCATGTACTTGGAAGGGGAAGGTCTTGGGGATCTTTTAAGTTTCTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCATCGGAACCCAAGACATCGAAAACAGCTAAAGCCATATATCGCTGGTATGTACAAAATAGTTC
  5   1   2       bld Ga18                              xlk140k11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                             ATTCCCGCTTCTCCAGATGGGGCAGGNCTCTAAATCTNCTACTTGATGACCAGNATGGAGCNNNNNNTTCCGCATGTACTTGGNAGGGGAAGGCTTGGGGATCTTTTAACTTTCTGGTTTGCTTGCAATGGATTTAGGGCTATGGACCCATTAGAACCCAAAANATCAAAAACAGCTAAAGCCATATATCGCTGGNATGTACAAAATAGC
  5   1   1       add Emb1                            IMAGE:5156726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ccacgcgtccgcccacgcgtccgcccacgcgtccggcAGGAGGCATTTACCTCCTTTTTGCAGTCTGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGACAGTCCTGGGCCAGGGCTTCCAACATTGGCTGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATTGGGAAAATAAATCGTGCCTTAGGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGAAAATCGGAACCAACCTATCCGTACTTTGCTCCTGCAGCCAGTATCAACGACAGTGAGATATCCAGCGATGCTTTGACAGAAGACAGTATGTCCATGACAGATGCGAGTGTAGATGGAATTCCGCCATATCGCTCAAAAAAGCAGAGGGAGATCCACCGGAGCGTCAGCGCCAATGGACAAGTGTCTTTGCCTTTTGTTCCAAGGACTATGCGTCCACCAGCGGAGATGATGCCAGCCAGTCCTGCAGAGTTTGCAGCCAAGCTGACGATGGCTTTGGAGAGAGTAAAGAAACAAAGGGAGGCTGAAGAGAAACTGGAAGAAAGGTTGCAGAGGTTAAAAGAGGATGAAGAAAAAGCCGACTATGACATCCCGCCATCCAATCACGAGACGGCACCTGTGGCTGCTTTAGAGGATGATCCACAGTCCATTCTTGATGACCATGTATCTAGAGTTCTGAAAACGCCAGCAAATCTCTCTCCAGGGCGCAGTCCCCTTTCGTTTCAAGAAAAGCAAATTTTCAACCAGCCTCCTCGAAAGGGCAGACTTCCGCATCCTGGTACTTGGCGTCCCCAAGTTCCTTCGGGGTATGGAAACGTCCTTCCACGTTTGGCATCCGAAGCACGAAGGCTCCTTGA
  5   1   1       add Ga18      out                     xlk154b03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCATTTACCTCCTTTTTGCAGTCTGATATATGCAAGGAGTATGCTCGTGGTGTTGAAGACAGTCCAACTCCAGACAGTCCTGGGCCAGGNNTTCCAACATTGGCTGAGGATGAGGAGTTTGGAGGGTTACACCATTTTTCTTCTGGAATTGGGAAAATAAATCGTGCCTTAGGTCGGATCCCTCCTAGAAACCAAAGGTCTCATTTTCGAAAATCGGAACCAACCTATCCGTACTTTGCTCCTGCAGCCAGTATCAACGACAGTGAGATATCCAGCGATGCTTTGACAGAAGACAGTATGTCCATGACAGATGCGAGTGTAGATGGAATTCCGCCGTATCGCTCAAAAAAGCAGAGGGAGATCCACCGGAGCGNNNNNNAATGGACAAGTGTCTTTGCCTTTTGTTCCAAGGACTATGCGTCCACCAGCGGAGATGATGCCAGCCAGTCCGGCAGAGTTTGCAGCCAAGCTGACGATGGCTTTGGAGAGAGTAAAGAAACAAAGGGAGGNTGAAGAGAAACTGGAAGAAAGGNTGCAGAGGTTAAAAGAGGATGAAGAAAAAGCCGACTATGACATCCCGCCATCCAATCACGAGACGGCNNCTGTGGCTGCTTTAGAGGANGATCCACAGTCCATCCTTGATGACCATGTATCTAGANNCTGAAAACGCCAGNAAATCTCTCTNCNAGGGCGCNGNNNNCTTTCGTTCAAAGAAANGNAATTNNAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)