Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012792537 Xl3.1-XL013c11.5 - 3 ESTs
                                                                       ....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL013c11.5                         ATTGAATTCGTCCCCGACTCCTTCTCCGGCAGTGGGAAGATGGCGGACTCAGATCGTGTAGGTTTTCCCATTGCCGGCACTGTACTAGCTGTCTCAAAAGAAAATGGCGAGCCCCTTTCTAAAAGGCAGCGCCTGGAAGATACCGGCGGCGGTGGTGGGCAGCTTGTAGGCGCTGAAAGCGAGGGGAAGGCGGCATTGCCGCCCGTAGCTACTTCTTTGCAGGAGGAAGGCGAGGCCTCTTCGGCAATGGAAAGCAAATCGAGAGCGCACAATGGCTCGGGCTTTCAGGGCCTTCCCTTGGAGAAGCGGCAGCTGGGAACATATTTGGTGCAAGGCCAGGAGGAGGGAGGAGCCGAGGAGTTACCCAATGGAGACCTGTCGGATCAGGCTATTGATTACGGAGGGAGTATCCATCTGGATGATGATCTTGCTGGCGGCTTTCATTCTTGTGACAGTGATGATGATGGCGCATCTCATGCCAGCTCAAGTGATTGGGCCCCCAGGCCTTGCATAGGGCCTTATACATTTGTACAACGGCACTTAATGATGGGAACGGATCCCCGGACAATTCTTAAGGATTTACTCCCTGACACTGTAGCACCATCAGAGTTAGATGATATGACTTTATGGCAAATTGTTATAAACATCCTTTCTGACCCACCAAAACGAAAGAAGCGCATAGACATCAACACTATT
                                                  Xl3.1-CHK-1012712841                               TTCGTCCCCGACTCCTTCTCCGGCAGTGGGAAGATGGCGGACTCAGATCGTGTAGGTTTTCCCATTGCCGGCACTGTACTAGCTGTCTCAAAAGAAAATGGCGAGCCCCTTTCTAAAAGGCAGCGCCTGGAAGATACCGGCGGCGGTGGTGGGCAGCTTGTAGGCGCTGAAAGCGAGGGGAAGGCGGCATTGCCGCCCGTAGCTACTTCTTTGCAGGAGGAAGGCGAGGCCTCTTCGGCAATGGAAAGCAAATCGAGAGCGCACAATGGCTCGGGCTTTCAGGGCCTTCCCTTGGAGAAGCGGCAGCTGGGAACATATTTGGTGCAAGGCCAGGAGGAGGGAGGAGCCGAGGAGTTACCCAATGGAGACCTGTCGGATCAGGCTATTGATTACGGAGGGAGTATCCATCTGGATGATGATCTTGCTGGCGGCTTTCATTCTTGTGACAGTGATGATGATGGCGCATCTCATGCCAGCTCAAGTGATTGGGCCCCCAGGCCTTGCATAGGGCCTTATACATTTGTACAACGGCACTTAATGATGGGAACGGATCCCCGGACAATTCTTAAGGATTTACTCCCTGACACTGTAGCACCATCAGAGTTAGATGATATGACTTTATGGCAAATTGTTATAAACATCCTTTCTGACCCACCAAAACGAAAGAAGCGCATAGACATCAACACTATTGATGAT
                                                      consensus depths                              1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      39     251                         
                                               BLH MIN      39      57                         
                                               BLH MPR      18      57                         
                                               BLH OVR      39     179                         
                                               CDS MIN      39      57                         
                                               ORF LNG      39       8                         
                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 6e-007     XP_001194744.1 PREDICTED: similar to sirtuin type 1, partial [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN --- Dm ---- 1e-009     NP_477351.1 CG5216-PA [Drosophila melanogaster] --------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 6e-011     BAE93342.1 zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 4e-029     XP_001334440.2 PREDICTED: im:7148963 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                      PROTEIN --- Gg ---- 2e-044     NP_001004767.1 NAD-dependent deacetylase sirtuin 1 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Hs ---- 2e-044     NP_036370.2 sirtuin 1; sir2-like 1; sirtuin type 1; SIR2alpha; sirtuin silent mating typeinformation regulation 2 homolog 1 (S. cerevisiae) [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN --- Mm ---- 7e-045     NP_062786.1 sirtuin 1 ((silent mating type information regulation 2, homolog) 1; sir2-like 1[Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PREDICTED = Bt ==== 9e-047     XP_869911.1 PREDICTED: similar to sirtuin type 1 isoform 2 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PREDICTED = Cf ==== 1e-047     XP_546130.2 PREDICTED: similar to NAD-dependent deacetylase sirtuin-1 (hSIRT1) (hSIR2) (SIR2-like protein 1) isoform 1 [Canis familiaris] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN === Xt ==== 9e-114     CAL49361.1 sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PREDICTED = Xl ==== 3e-124     NP_001091195.1 hypothetical protein LOC100036963 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL013c11.5                                                                ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------ATG
                                                                   ORF                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Thy  5x3  out                   IMAGE:8548697.5p CCTAGAGTGNNNNNGAGAACATATATTGAATTCGTCCCCGACTCCTTCTCCGGCAGTGGGAAGATGGCGGACTCAGATCGTGTAGGTTTTCCCATTGCCGGCACTGTACTAGCTGTCTCAAAAGAAAATGGCGAGCCCCTTTCTAAAAGGCAGCGCCTGGAAGATACCGGCGGCGGTGGTGGGCAGCTTGTAGGCGCTGAAAGCGAGGGGAAGGCGGCATTGCCGCCCGTAGCTACTTCTTTGCAGGAGGAAGGCGAGGCCTCTTCGGCAATGGAAAGCAAATCGAGAGCGCACAATGGCTCGGGCTTTCAGGGCCTTCCCTTGGAGAAGCGGCAGCTGGGAACATATTTGGTGCAAGGCCAGGAGGAGGGAGGAGCCGAGGAGTTACCCAATGGAGACCTGTCGGATCAGGCTATTGATTACGGAGGGAGTATCCATCTGGATGATGATCTTGCTGGCGGCTTTCATTCTTGTGACAGTGATGATGATGGCGCATCTCATGCCAGCTCAAGTGATTGGGCCCCCAGGCCTTGCATAGGGCCTTATACATTTGTACAACGGCACTTAATGATGGGAACGGATCCCCGGACAATTCTTAAGGATTTACTCCCTGACACTGTAGCACCATCAGAGTTAGATGATATGACTTTATGGCAAATTGTTATAAACATCCTTTCTGACCCACCAAAACGAAAGAAGCGCATAGACATCAACACTATTGATGATGCT
  5   1   2       bld Neu7 5g                              XL013c11.5p                                                 TCCGGCAGTGGGAAGATGGCGGACTCAGATCGTGTAGGTTTTCCCATTGCCGGCACAGTACTAGCTGTCTCAAAAGAAAATGGCGAGCCCCTTTCTAAAAGGCAGCGCCTGGAAGATACCGGCGGCGGTGGTGGGCAGCTTGTAGGCGCTGAAAGCGAGGGGAAGGCGGCATTGCCGCCCGTAGCTACTTCTTTGCAGGAGGAAGGCGAGGCCTCTTCGGCAATGGAAAGCAAATCGAGAGCGCACAATGGCTCGGGCTTTCAGGGCCTTCCCTTGGAGAAGCGGCAGCTGGGAACATATTTGGTACAAGGCCAGGAGGAGGGAGGAGCCGAGGAGTTACCCAATGGAGACCTGTCGGATCAGGCTATTGATTACGGAGGGAGTATCCATCTGGATGATGATCTTGCTGGCGGCTTTCATTCTTGTGACAGtgatgatgatgatgatgGCGCATCTCATGCCAGCTCAAGTGATTGGGCCCCCAGGCCTTGCATAGGGCCTTATACATTTG
  5   1   2      seed Brn2 5g                          Brn2-za39b04.5p                                                      GAGTGGGAAGATGGCGGACTCAGATCGTGTAGGTTTTCCCATTGCCGGCACTGTACTAGCTGTCTCAAAAGAAAATGGCGAGCCCCTTTCTAAAAGGCAGCGCCTGGAAGATACCGGCGGCGGTGGTGGGCAGCTTGTAGGCGCTGAAAGCGAGGGGAAGGCGGCATTGCCGCCCGTAGCTACTTCTTTGCAGGAGGAAGGCGAGGCCTCTTCGGCAATGGAAAGCAAATCGAGAGCGCACAATGGCTCGGGCTTTCAGGGCCTTCCCTTGGAGAAGCGGCAGCTGGGAACATATTTGGTGCAAGGCCAGGAGGAGGGAGGAGCCGAGGAGTTACCCAATGGAGACCTGTCGGATCAGGCTATTGATTACGGAGGGAGTATCCATCTGGATGATGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)