Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:6859017.5                       7 END     3          75       42                hypothetical protein LOC100037075 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012792850 Xl3.1-xl255l06.3 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl255l06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAANAAATTAAA------------AGGATNGTTCAGAGATGACGACGAGATATTAATGATAGCTTCTATGGCGCCGGTGTGAACCTCTCTGAAGAAGTGCAAGGATATTTGGCAACGAATTCGGAGTTAGTGGGCACGTTAACGCGCTCCTGCAAAGACGAGACGTTTCTTCTGCCTGCACTGCTACAGAGGAGGATATTGGAAATAGGTAAAAAGCACGGAATCACAGAAATCCATCAGGACGTTGTCAGTTATGTCTCCCACGCAACACAACAGCGGCTACAAAGCATTGTAGAAAAAATCTCTGAAACAGCGCAGCAAAAGAATATTTCACACAAGGACGACGATAGGTATGAACAAACCAGCGACGTACGGACGCAGCTCAAATTCTTCGAGCAGCTTGATCATATCGAGAAGCAGAGGAAAGATGAGCAGGAGCGAGAGATTCTTATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCGGAACAATTACGGCTAAAACAGAAGGCTAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGATGCTAATTTAACAGCGCTAGCAGCTATTGGCCCTCGAAAGAAGAGGAAAGTCGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACAGCCACGGCCAGCAGTTCTGCAGGAGGGAGCAGCCGACAGTTTACAAGACAAAGGATAACGCGAGTCAATCTCAGGGACCTCATATTATGTTTGGAGAGTGAACGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAAACTCACAAAACTCAACA
                                                  Xl3.1-CHK-1012707812                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTAAAAGAGCC------------GTTCAGAGATGAxxxxxxGATATTAATGATxxxxxxTxTxxxGCCGGTGTGAACCTCTCTGAAGAAxxxxxAGGATATTxGxxAACGAATTCGGAGTTAGTGGGCACGTTAACGCGCTCCTGCAAAGACGAGACGTTTCTTCTGCCTGCACTGCTACAGAGGAGGATATTGGAAATAGGTAAAAAGCACGGAATCACAGAAATCCATCAGGACGTTGTCAGTTATGTCTCCCACGCAACACAACAGCGGCTACAAAGCATTGTAGAAAAAATCTCTGAAACAGCGCAGCAAAAGAATATTTCACACAAGGACGACGATAGGTATGAACAAACCAGCGACGTACGGACGCAGCTCAAATTCTTCGAGCAGCTTGATCATATCGAGAAGCAGAGGAAAGATGAGCAGGAGCGAGAGATTCTTATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCGGAACAATTACGGCTAAAACAGAAGGCTAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGATGCTAATTTAACAGCGCTAGCAGCTATTGGCCCTCGAAAGAAGAGGAAAGTCGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACAGCCACGGCCAGCAGTTCTGCAGGAGGGAGCAGCCGACAGTTTACAAGACAAAGGATAACGCGAGTCAATCTCAGGGACCTCATATTATGTTTGGAGAGTGAACGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAAACTCACAAAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     0     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     4     4     4     4     4     3     4     4     4     3     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     1     2     1     2     2     2     1     1
                                               BLH MIN      45     121                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 2e-013     NP_490728.2 TAF (TBP-associated transcription factor) family member (taf-4) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 8e-015     XP_641818.1 hypothetical protein DDBDRAFT_0218154 [Dictyostelium discoideum AX4] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-058     NP_996101.1 CG5444-PD, isoform D [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 2e-063     XP_315737.4 AGAP005719-PA [Anopheles gambiae str. PEST] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 9e-069     XP_001178335.1 PREDICTED: similar to TBP-associated factor [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 8e-091     XP_692554.3 PREDICTED: similar to TAF4A RNA polymerase II, TATA box binding protein (TBP)-associated factor [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 4e-115     XP_001477147.1 PREDICTED: similar to TAF4A RNA polymerase II, TATA box binding protein (TBP)-associated factor [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-115     NP_003176.2 TBP-associated factor 4 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 5e-116     XP_417400.2 PREDICTED: hypothetical protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 2e-117     XP_001787979.1 PREDICTED: similar to TBP-associated factor 4 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 2e-117     XP_534471.2 PREDICTED: similar to TBP-associated factor 4 [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xt ---- 2e-129     NP_001072285.1 hypothetical protein LOC779738 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 4e-131     NP_001091268.1 hypothetical protein LOC100037075 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl255l06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                              ]
  3   1   2      skin Ga18      out                     xlk105p20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCAGNANAGNNAAANAAATTAAAAGAGCCGNGGGNAGGATNGTTCAGAGATGACGACGATATTANTNNTGTAGCTTCTATGGCCNGNTGTGANCCTCTCTGNAGAAAGTGCAAGGATATTGGCAANCGNNTTCGGAGTTAGNGGGCACGTTAACGCNCTCCTGCAAAGNCGAGNCGTTTCTTCTNNCTGNACTGCNACAGAGGAGGATATTGGAAATAGGTAAAAAGCACGGAATCACAGAAATCCATCAGGACGTTGTCAGTTATNTCTCCCACGCAACACAACAGCGGCTACAAAGCATTGTAGAAAAAATCTCTGAAACANCGCAGCAAAAGAATATTTCACACAAGGACGACGATAGGTATGAACAAACCAGCGACGTACGGACGCAGCTCAAATTCTTCGAGCAGCTTGATCATATCGAGAAGCAGAGGAAAGATGAGCAGGAGCGAGAGATTCTTATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCGGAACAATTACGGCTAAAACAGAAGGCTAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGATGCTAATTTAACAGCGCTAGCAGCTATTGGCCCTCGAAAGAAGAGGAAAGTCGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTANNNCACGGCCAGCAGTTCTGCAGGAGGGAGCAGCCGACAGTTTACAAGACAAAGGATAACGCGAGTCAATCTCAGGGACCTCATATTATGTTTGGAGAGTGAACGAGANNNNCCNTTCNCTATTNCTATACA
  3   1   2       bld DMZ       out                        xl255l06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCGTTCAGAGATGACGACGATATTAATGATGTAGCTTCTATGGCCGGTGTGAACCTCTCTGAAGAAAGTGCAAGGATATTGGCAACGAATTCGGAGTTAGTGGGCACGTTAACGCGCTCCTGCAAAGACGAGACGTTTCTTCTGCCTGCACTGCTACAGAGGAGGATATTGGAAATAGGTAAAAAGCACGGAATCACAGAAATCCATCAGGACGTTGTCAGTTATGTCTCCCACGCAACACAACAGCGGCTACAAAGCATTGTAGAAAAAATCTCTGAAACAGCGCAGCAAAAGAATATTTCACACAAGGACGACGATAGGTATGAACAAACCAGCGACGTACGGACGCAGCTCAAATTCTTCGAGCAGCTTGATCATATCGAGAAGCAGAGGAAAGATGAGCAGGAGCGAGAGATTCTTATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCGGAACAATTACGGCTAAAACAGAAGGCTAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGATGCTAATTTAACAGCGCTAGCAGCTATTGGCCCTCGAAAGAAGAGGAAAGTCGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACAGCCACGGCCAGCAGTTCTGCAGGAGGGAGCAGCCGACAGTTTACAAGACAAAGGATAACGCGAGTCAATCTCAGGGACCTCATATTATGTTTGGAGAGTGAACGAGAGACAAGCCAT
  3   1   2      seed Oo1       out                   IMAGE:3404969.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGTAGAAAAAATCTCTGAANCAGCGCAGCAAAAGAATATTTCACACAAGGACGACGATAGGTATGAACAAACCAGCGACGTACGGACGCAGCTCAAATTCTTCGAGCAGCTTGATCATATCGAGAAGCAGAGGAAAGATGAGCAGGAGCGAGAGATTCTTATGCGGGCAGCTAAGTCTCGGTCAAGGCAGGAGGATCCGGAACAATTACGGCTAAAACAGAAGGCTAAAGAGATGCAACAGCAGGAACTGGCACAAATGAGGCAGAGAGATGCTAATTTAACAGCGCTAGCAGCTATTGGCCCTCGAAAGAAGAGGAAAGTCGAATCACCGGGCCCTGGTTCTGGTTCAGAGTCGTCCAGCACAAGTACAGCCACGGCCAGCAGTTCTGCAGGAGGGAGCAGCCGACAGTTTACAAGACAAAGGATAACGCGAGTCAATCTCAGGGACCTCATATTATGTTTGGAGAGTGAACGAGAGACAAGCCATTCACTATTGCTATACAAAGCATTCCTTAAGTGAAACTCACAAAACTCAACAC
  3   1   2       add Ga12                                 XL193f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATAAAGAGATGCAACAGCAGGAACTGGCACNAATGAGGCAGAGAGATGNTAATNTAACAGCNCTAGCAGNTATTGGCCCTNGAAAGAAGANGAAAGTNGAATCNCCGGGCCCTGGTTNTGNTTCAGAGTCGTCCAGCACAAGTACAGCCACGGCCAGCAGTTCTGCAGGAGGGAGCAGCCGACAGTTTACAAGACAAAGGATAACGNGAGTCAATCTCAGNGACCTCATANTATGTCTGGAGAGTGAACGAGAGACAAGCCATTCACCTATTGCTATACAAAGCATTCCTTAAGGAAACTCACAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)