Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL216a11.3                           14 PI      75         36      760                Unknown (protein for IMAGE:7677973) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012792861 Xl3.1-IMAGE:4930216-IMAGp.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4930216-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGAAACCTTTGTGGACAAACTAGTTCAGGAGCAGGGAACCCACTCCAAGTTCCAGAAGCCACGCCAACTTAAGGACAAGGCAGATTTCTGCATCATCCACTATGCTGGAAGGGTGGATTATAAGGCAGATGAATGGCTATTGAAGAACATGGATCCTCTGAATGACAATGTTGCTACTCTGCTTCATCAGTCCTCTGACAAGTTTGTGAGCGAGCTATGGAAAGATGTGGATCGCATTGTGGGGTTGGACCAGGTTGCAGGAATGGCAGAGACTGCTTTCGGAGCAGCATACAAAACCAAGAAGGGCATGTTCCGCACAGTTGGGCAGCTGTACAAGGAGTCCCTGGCAAAGCTGATGGCAACTCTGCGCAACACAAACCCCAACTTTGTCCGCTGCATCATCCCCAATCATGAAAAGCGGGCAGGGAAACTCGACCCACATTTAGTGCTGGATCAGCTGAGGTGTAATGGTGTCTTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGTATTGTATTCCAGGAGTTCCGTCAAAGATATGAGATCCTCACACCCAACTCCATCCCTAGAGGGTTCATGGATGGGAAGCAGGCATGCGAGCGAATGATCCGGTCTTTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCTGGCGTCCTGGCTCATCTGGAGGAGGAAAGAGACCTAAAGATCACTGATATTATCGTACTCCTTCCAGCTGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGNCCAAGAAACAACAACAGCTGATTGGCCCTCAAAGTGCTGCAGAAGAAA
                                                  Xl3.1-CHK-1012718028                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCCGCCCACGCGTCCGCCCACGCGTCCGAAACCTTTGTGGACAAACTAGTTCAGGAGCAGGGAACCCACTCCAAGTTCCAGAAGCCACGCCAACTTAAGGACAAGGCAGATTTCTGCATCATCCACTATGCTGGAAGGGTGGATTATAAGGCAGATGAATGGCTATTGAAGAACATGGATCCTCTGAATGACAATGTTGCTACTCTGCTTCATCAGTCCTCTGACAAGTTTGTGAGCGAGCTATGGAAAGATGTGGATCGCATTGTGGGGTTGGACCAGGTTGCAGGAATGGCAGAGACTGCTTTCGGAGCAGCATACAAAACCAAGAAGGGCATGTTCCGCACAGTTGGGCAGCTGTACAAGGAGTCCCTGGCAAAGCTGATGGCAACTCTGCGCAACACAAACCCCAACTTTGTCCGCTGCATCATCCCCAATCATGAAAAGCGGGCAGGGAAACTCGACCCACATTTAGTGCTGGATCAGCTGAGGTGTAATGGTGTCTTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGTATTGTATTCCAGGAGTTCCGTCAAAGATATGAGATCCTCACACCCAACTCCATCCCTAGAGGGTTCATGGATGGGAAGCAGGCATGCGAGCGAATGATCCGGTCTTTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCTGGCGTCCTGGCTCATCTGGAGGAGGAAAGAGACCTAAAGATCACTGATATTATCGTACTCCTTCCAGCTGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGNCCAAGAAACAACAACAGCTGATTGGCCCTCAAAGTGCTGCAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN      34     173                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ce ---- 1e-091     NP_508504.2 Non-muscle MYosin NMY-1 (nmy-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 6e-100     XP_001182950.1 PREDICTED: similar to CG15792-PD, partial [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 7e-103     XP_308355.3 AGAP007523-PB [Anopheles gambiae str. PEST] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-103     NP_001014553.1 CG15792-PC, isoform C [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 1e-118     XP_887804.3 PREDICTED: similar to myosin, heavy chain 14 isoform 4 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 6e-140     NP_990805.1 nonmuscle myosin heavy chain [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-142     XP_860794.1 PREDICTED: similar to myosin, heavy polypeptide 10, non-muscle isoform 6 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 5e-143     NP_005955.1 myosin, heavy polypeptide 10, non-muscle; myosin heavy chain, nonmuscle type B;cellular myosin heavy chain, type B type B [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 4e-143     XP_683046.3 PREDICTED: myosin, heavy polypeptide 10, non-muscle [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 4e-143     NP_780469.1 non-muscle myosin heavy chain 10; nonmuscle myosin heavy chain IIB [Musmusculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 3e-143     NP_777259.1 myosin, heavy polypeptide 10, non-muscle [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 9e-146     AAI66177.1 Unknown (protein for IMAGE:7677973) [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-148     NP_001084034.1 nonmuscle myosin heavy chain b [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4930216-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2      seed Emb4                            IMAGE:4930216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ccacgcgtccgcccacgcgtccgcccacgcgtccgAAACCTTTGTGGACAAACTAGTTCAGGAGCAGGGAACCCACTCCAAGTTCCAGAAGCCACGCCAACTTAAGGACAAGGCAGATTTCTGCATCATCCACTATGCTGGAAGGGTGGATTATAAGGCAGATGAATGGCTATTGAAGAACATGGATCCTCTGAATGACAATGTTGCTACTCTGCTTCATCAGTCCTCTGACAAGTTTGTGAGCGAGCTATGGAAAGATGTGGATCGCATTGTGGGGTTGGACCAGGTTGCAGGAATGGCAGAGACTGCTTTCGGAGCAGCATACAAAACCAAGAAGGGCATGTTCCGCACAGTTGGGCAGCTGTACAAGGAGTCCCTGGCAAAGCTGATGGCAACTCTGCGCAACACAAACCCCAACTTTGTCCGCTGCATCATCCCCAATCATGAAAAGCGGGCAGGGAAACTCGACCCACATTTAGTGCTGGATCAGCTGAGGTGTAATGGTGTCTTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGTATTGTATTCCAGGAGTTCCGTCAAAGATATGAGATCCTCACACCCAACTCCATCCCTAGAGGGTTCATGGATGGGAAGCAGGCATGCGAGCGAATGATCCGGTCTTTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCTGGCGTCCTGGCTCATCTGGAGGAGGAAAGAGACCTAAAGATCACTGATATTATCGTACTCCTTCCAGCTGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGNCCAAGAAACAACAACAGCTGATTGGCCCTCAAAGTGCTGCAGAAGAAACTGT
  5   1   2       bld Emb4                   IMAGE:4930216-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACCTTTGTGGACAAACTAGTTCAGGAGCAGGGAACCCACTCCAAGTTCCAGAAGCCACGCCAACTTAAGGACAAGGCAGATTTCTGCATCATCCACTATGCTGGAAGGGTGGATTATAAGGCAGATGAATGGCTATTGAAGAACATGGATCCTCTGAATGACAATGTTGCTACTCTGCTTCATCAGTCCTCTGACAAGTTTGTGAGCGAGCTATGGAAAGATGTGGATCGCATTGTGGGGTTGGACCAGGTTGCAGGAATGGCAGAGACTGCTTTCGGAGCAGCATACAAAACCAAGAAGGGCATGTTCCGCACAGTTGGGCAGCTGTACAAGGAGTCCCTGGCAAAGCTGATGGCAACTCTGCGCAACACAAACCCCAACTTTGTCCGCTGCATCATCCCCAATCATGAAAAGCGGGCAGGGAAACTCGACCCACATTTAGTGCTGGATCAGCTGAGGTGTAATGGTGTCTTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGTATTGTATTCCAGGAGTTCCGTCAAAGATATGAGATCCTCACACCCAACTCCATCCCTAGAGGGTTCATGGATGGGAAGCAGGCATGCGAGCGAATGATCCGGTCTTTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCTGGCGTCCTGGCTCATCTGGAGGAGGAAAAGAGACCTAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)