Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 06 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

 This cluster: approximate FL confidence score = 0%

 1012793078 Xl3.1-IMAGE:4057359.5 - 3 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                            PROTEIN --- Dm ---- 2e-020     NP_724053.1 CG6667-PB, isoform B [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 2e-024     XP_001179144.1 PREDICTED: similar to C-Rel protein [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Ci ---- 5e-031     BAE06668.1 RelA [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Bt ---- 2e-040     NP_001073711.1 v-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa light polypeptide gene enhancer in B-cells 3, p65 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Dr ---- 2e-048     NP_001001841.2 v-rel reticuloendotheliosis viral oncogene homolog [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Hs ---- 2e-053     NP_002899.1 v-rel reticuloendotheliosis viral oncogene homolog; Oncogene REL, avianreticuloendotheliosis; v-rel avian reticuloendotheliosis viral oncogene homolog[Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PREDICTED - Cf ---- 4e-055     XP_531836.2 PREDICTED: similar to v-rel reticuloendotheliosis viral oncogene homolog [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Mm ---- 2e-055     NP_033070.2 reticuloendotheliosis oncogene [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PREDICTED - ?? ---- 9e-057     XP_869653.2 PREDICTED: similar to REL protein isoform 3 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PREDICTED - Gg ---- 5e-057     XP_419277.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Xt ---- 2e-156     NP_001096177.1 v-rel reticuloendotheliosis viral oncogene homolog [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Xl ---- 0          NP_001081750.1 rel-related embryonic oncoprotein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4057359.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------ATG---------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------TAG------------------------TAG---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Sp1                             IMAGE:4964969.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTCCCAACACCGCTGAGCTGAGGATATGCCGTGTCAACAAGAACTGTGGAAGTGTAAATGGTGGAGATGAAATATTCCTTCTGTGCGATAAAGTTCAGAAAGATGACATAGAAGTCAGGTTTTTTACAGACAACTGGGAAGCCAAAGGGACATTTGGACAAGCCGATGTGCACCGTCAGGTAGCCATTGTATTCAAAACGCCCCCATTTCTTCGATCCATCGCTGATGCTGTGACAGTAAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGTGAACCTATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCAGAAGTGATGCAGAAGTTCAAATTTGAAATACAAGAGAGACGTGAACCAATTCCTGGAAAATTCAATGTAAATCCAATTAAGAGAGAACATTTTGCAACTTCATCAGGGTGTGGACAACGTTTCCATACAATGCAGCCCACAACAAGGCCACCTAATGTTGTTTATAATGACTGCACCTCAAACTTCAGCTCAAGTCTTGCTCAACTGGCTG
  5   1   2      seed Lu1       out                   IMAGE:4057359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGCGTCCGGGCCTTCTGACCAGGAGGTCAGTGAACCTATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCAGAAGTGATGCAGAAGTTCAAATTTGAAATACAAGAGAGACGTGAACCAATTCCTGGAAAATTCAATGTAAATCCAATTAAGAGAGAACATTTTGCAACTTCATCAGGGTGTGGACAACATTTCCATACAATGCAGCCCACAACAAGGCCACCTAATGTTGTTTATAATGACTGCACCTCAAACTTCAGCTCAAGTCTTGCTCAACTGGCTGTTTTGAACCCTCACGTGCAGACTAACATGCACAGCACCAACAGCAGCGCCATTAATAATATCATGGAAAGTTTGAGGGCAGTTCCATTTCATTCA
  5   1   2       bld Lu1                    IMAGE:4057359-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCTTCTGACCAGGAGGTCAGTGAACCTATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCAGAAGTGATGCAGAAGTTCAAATTTGAAATACAAGAGAGACGTGAACCAATTCCTGGAAAATTCAATGTAAATCCAATTAAGAGAGAACATTTTGCAACTTCATCAGGGTGTGGACAACATTTCCATACAATGCAGCCCACAACAAGGCCACCTAATGTTGTTTATAATGACTGCACCTCAAACTTCAGCTCAAGTCTTGCTCAACTGGCTGTTTTGAACCCTCACGTGCAGACTAACATGCACAGCACCAACAGCAGCGCCATTAATAATATCATGGAAAGTTTGAGGGCAGTTCCATCACATCCAAACACTTACAAACTCCCATTCAATGAGCCCAATCAGTCAAGACCTGATGTAGCCACCAGCAACAGCAGCAATATGTTCAGACAGCCGTATTTCAATTTTAATGTAGCCAGTAGCAGTGGGCAGGTTTCCAATTGCCCTAGTGCCCCATGTGACATGAATTTATATACATCACCTGCAAATCCTATGGATATAAGCGAGATTGGTCAAATGACAACCAGTACAGTAAATGCTCCCAGTATCTCAAGTTTATCGTGTAATGGTGTTCAGGCCAATAGTATGTTTAATACACCATTTAGTTACCACCCAGCAATAAATGAGCCAAGGCTACCAGACGCCAATGTTGTGGCTCCGCACAGAACATCTATGGGCCATGAAATCTACTCAGACATTGTACAAAGCGATGACCATTATATCAGTGTGGAATCCGAACTTGAAAGCATATTGCAGAACTTTGGAAGTTCAAGTGAAATGTTACATGACTAGCGATTGCTCACAATCTGGGCCTTTTAGTGCTAACTG

In case of problems mail me! (