Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012793078 Xl3.1-IMAGE:4057359.5 - 3 ESTs
                                                                       .....-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4057359.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTCCCAACACCGCTGAGCTGAGGATATGCCGTGTCAACAAGAACTGTGGAAGTGTAAATGGTGGAGATGAAATATTCCTTCTGTGCGATAAAGTTCAGAAAGATGACATAGAAGTCAGGTTTTTTACAGACAACTGGGAAGCCAAAGGGACATTTGGACAAGCCGATGTGCACCGTCAGGTAGCCATTGTATTCAAAACGCCCCCATTTCTTCGATCCATCGCTGATGCTGTGACAGTAAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGTGAACCTATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCAGAAGTGATGCAGAAGTTCAAATTTGAAATACAAGAGAGACGTGAACCAATTCCTGGAAAATTCAATGTAAATCCAATTAAGAGAGAACATTTTGCAACTTCATCAGGGTGTGGACAACATTTCCATACAATGCAGCCCACAACAAGGCCACCTAATGTTGTTTATAATGACTGCACCTCAAACTTCAGCTCAAGTCTTGCTCAACTGGCTGTTTTGAACCCTCACGTGCAGACTAACATGCACAGCACCAACAGCAGCGCCATTAATAATATCATGGAAAGTTTGAGGGCAGTTCCATCACATCCAAACACTTACAAACTCCCATTCAATGAGCCCAATCAGTCAAGACCTGATGTAGCCACCAGCAACAGCAGCAATATGTTCAGACAGCCGTATTTCAATTTTAATGTAGCCAGTAGCAGTGGGCAGGTTTCCAATTGCCCTAGTGCCCCATGTGACATGAATTTATATACATCACCTGCAAATCCTATGGATATAAGCGAGATTGGTCAAATGACAACCAGTACAGTAAATGCTCCCAGTATCTCAAGTTTATCGTGTAATGGTGTTCAGGCCAATAGTATGTTTAATACACCATTTAGTTACCACCCAGCAATAAATGAGCCAAGGCTACCAGACGCCAATGTTGTGGCTCCGCACAGAACATCTATGGGCCATGAAATCTACTCAGACATTGTACAAAGCGATGACCATTATATCAGTGTGGAATCCGAACTTGAAAGCATATTGCAGAACTTTGGAAGTTCAAGTGAAATGTTACATGACTAGCGATTGCTCACAATCTGGGCCTTTTAGTGCTAA
                                                  Xl3.1-CHK-1012713609                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACACCGCTGAGCTGAGGATATGCCGTGTCAACAAGAACTGTGGAAGTGTAAATGGTGGAGATGAAATATTCCTTCTGTGCGATAAAGTTCAGAAAGATGACATAGAAGTCAGGTTTTTTACAGACAACTGGGAAGCCAAAGGGACATTTGGACAAGCCGATGTGCACCGTCAGGTAGCCATTGTATTCAAAACGCCCCCATTTCTTCGATCCATCGCTGATGCTGTGACAGTAAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGTGAACCTATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCAGAAGTGATGCAGAAGTTCAAATTTGAAATACAAGAGAGACGTGAACCAATTCCTGGAAAATTCAATGTAAATCCAATTAAGAGAGAACATTTTGCAACTTCATCAGGGTGTGGACAACATTTCCATACAATGCAGCCCACAACAAGGCCACCTAATGTTGTTTATAATGACTGCACCTCAAACTTCAGCTCAAGTCTTGCTCAACTGGCTGTTTTGAACCCTCACGTGCAGACTAACATGCACAGCACCAACAGCAGCGCCATTAATAATATCATGGAAAGTTTGAGGGCAGTTCCATCACATCCAAACACTTACAAACTCCCATTCAATGAGCCCAATCAGTCAAGACCTGATGTAGCCACCAGCAACAGCAGCAATATGTTCAGACAGCCGTATTTCAATTTTAATGTAGCCAGTAGCAGTGGGCAGGTTTCCAATTGCCCTAGTGCCCCATGTGACATGAATTTATATACATCACCTGCAAATCCTATGGATATAAGCGAGATTGGTCAAATGACAACCAGTACAGTAAATGCTCCCAGTATCTCAAGTTTATCGTGTAATGGTGTTCAGGCCAATAGTATGTTTAATACACCATTTAGTTACCACCCAGCAATAAATGAGCCAAGGCTACCAGACGCCAATGTTGTGGCTCCGCACAGAACATCTATGGGCCATGAAATCTACTCAGACATTGTACAAAGCGATGACCATTATATCAGTGTGGAATCCGAACTTGAAAGCATATTGCAGAACTTTGGAAGTTCAAGTGAAATGTTACATGACTAGCGATTGCTCACAATCTGGGCCTTTTAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                            PROTEIN --- Dm ---- 2e-020     NP_724053.1 CG6667-PB, isoform B [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 2e-024     XP_001179144.1 PREDICTED: similar to C-Rel protein [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Ci ---- 5e-031     BAE06668.1 RelA [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Bt ---- 2e-040     NP_001073711.1 v-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa light polypeptide gene enhancer in B-cells 3, p65 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Dr ---- 2e-048     NP_001001841.2 v-rel reticuloendotheliosis viral oncogene homolog [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Hs ---- 2e-053     NP_002899.1 v-rel reticuloendotheliosis viral oncogene homolog; Oncogene REL, avianreticuloendotheliosis; v-rel avian reticuloendotheliosis viral oncogene homolog[Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PREDICTED - Cf ---- 4e-055     XP_531836.2 PREDICTED: similar to v-rel reticuloendotheliosis viral oncogene homolog [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Mm ---- 2e-055     NP_033070.2 reticuloendotheliosis oncogene [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PREDICTED - ?? ---- 9e-057     XP_869653.2 PREDICTED: similar to REL protein isoform 3 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PREDICTED - Gg ---- 5e-057     XP_419277.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Xt ---- 2e-156     NP_001096177.1 v-rel reticuloendotheliosis viral oncogene homolog [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Xl ---- 0          NP_001081750.1 rel-related embryonic oncoprotein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4057359.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------ATG---------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------TAG------------------------TAG---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Sp1                             IMAGE:4964969.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTCCCAACACCGCTGAGCTGAGGATATGCCGTGTCAACAAGAACTGTGGAAGTGTAAATGGTGGAGATGAAATATTCCTTCTGTGCGATAAAGTTCAGAAAGATGACATAGAAGTCAGGTTTTTTACAGACAACTGGGAAGCCAAAGGGACATTTGGACAAGCCGATGTGCACCGTCAGGTAGCCATTGTATTCAAAACGCCCCCATTTCTTCGATCCATCGCTGATGCTGTGACAGTAAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGTGAACCTATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCAGAAGTGATGCAGAAGTTCAAATTTGAAATACAAGAGAGACGTGAACCAATTCCTGGAAAATTCAATGTAAATCCAATTAAGAGAGAACATTTTGCAACTTCATCAGGGTGTGGACAACGTTTCCATACAATGCAGCCCACAACAAGGCCACCTAATGTTGTTTATAATGACTGCACCTCAAACTTCAGCTCAAGTCTTGCTCAACTGGCTG
  5   1   2      seed Lu1       out                   IMAGE:4057359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGCGTCCGGGCCTTCTGACCAGGAGGTCAGTGAACCTATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCAGAAGTGATGCAGAAGTTCAAATTTGAAATACAAGAGAGACGTGAACCAATTCCTGGAAAATTCAATGTAAATCCAATTAAGAGAGAACATTTTGCAACTTCATCAGGGTGTGGACAACATTTCCATACAATGCAGCCCACAACAAGGCCACCTAATGTTGTTTATAATGACTGCACCTCAAACTTCAGCTCAAGTCTTGCTCAACTGGCTGTTTTGAACCCTCACGTGCAGACTAACATGCACAGCACCAACAGCAGCGCCATTAATAATATCATGGAAAGTTTGAGGGCAGTTCCATTTCATTCA
  5   1   2       bld Lu1                    IMAGE:4057359-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCTTCTGACCAGGAGGTCAGTGAACCTATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCAGAAGTGATGCAGAAGTTCAAATTTGAAATACAAGAGAGACGTGAACCAATTCCTGGAAAATTCAATGTAAATCCAATTAAGAGAGAACATTTTGCAACTTCATCAGGGTGTGGACAACATTTCCATACAATGCAGCCCACAACAAGGCCACCTAATGTTGTTTATAATGACTGCACCTCAAACTTCAGCTCAAGTCTTGCTCAACTGGCTGTTTTGAACCCTCACGTGCAGACTAACATGCACAGCACCAACAGCAGCGCCATTAATAATATCATGGAAAGTTTGAGGGCAGTTCCATCACATCCAAACACTTACAAACTCCCATTCAATGAGCCCAATCAGTCAAGACCTGATGTAGCCACCAGCAACAGCAGCAATATGTTCAGACAGCCGTATTTCAATTTTAATGTAGCCAGTAGCAGTGGGCAGGTTTCCAATTGCCCTAGTGCCCCATGTGACATGAATTTATATACATCACCTGCAAATCCTATGGATATAAGCGAGATTGGTCAAATGACAACCAGTACAGTAAATGCTCCCAGTATCTCAAGTTTATCGTGTAATGGTGTTCAGGCCAATAGTATGTTTAATACACCATTTAGTTACCACCCAGCAATAAATGAGCCAAGGCTACCAGACGCCAATGTTGTGGCTCCGCACAGAACATCTATGGGCCATGAAATCTACTCAGACATTGTACAAAGCGATGACCATTATATCAGTGTGGAATCCGAACTTGAAAGCATATTGCAGAACTTTGGAAGTTCAAGTGAAATGTTACATGACTAGCGATTGCTCACAATCTGGGCCTTTTAGTGCTAACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)