Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 27 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL483f05ex.5                         14 END     1          25        7                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6874250.3                       5 PI      84        258      886                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4084544.3                       4 PI      84        196      910                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012793268 Xl3.1-xlk162l12ex.3 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk162l12ex.3 TGTAAGAAATATCAATGCAAGAACTGTCCCAAAACTTCTCTTCGAAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGCTGTGTAGCACATTAGATCGTCATATGTTTACCAGGACTCCACACTTCCCTTCAGGGTTTCTGGTGTAAAAGAATTCCAAACATATATTTCTTACCTCTTTNTTCCTTTCCTATGAAAAGGAAAGCCTATGCAAGATCTACCAAAACGTCAGCATTTCAAGTCTGATTTGCAGTATGGATTACAAATAATAGAAACACTTTTCCGTATGGCAGCAAGGATTAATGAAATGGTCCTTAGATACGCCATATTTCCTTGGCATGAATAAATCAAGCACATATGTAGAGAATGGCTCTTGTCTAGACAATCCAGCAAAAATCCAAAGGACTTTCAGCCTCGTTCTCAGGTGCTTTACTAAGCAGCCCAATGAAATCTTCTCTTCCTGAATTTATAAGACTCTTAAACTATGCCATTGGGTATTGTCATTGTTTTTAGCTAGGCTCCATTTGTGCCTTTTACAGCCATTGCCTTCAGACATTCCTTTGTTTTATTTAAGACTTTTTACAAAAAAAATTTTTATTATAAAATTGACAATTTTGCTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGGGAATGCGAAAATGTAGATCCTGAACTTTTCTTATGCACAAAGAAAATGCAACTTATTTTCGGGATTCTCCACCCTTCATGTGCCTTTTTTTTTATAATAATTTGTAAAATATGTGAATATTGTATATTTTGAAATGTTTATATTTTTCTATATGTGTGAGAATGTGGCGTGTGAAAGAGAGAAGCGGTGTGTAGCTGCTTCAGGGATAACTTGAAGTGATGTGCCAATTTTTTTTGTTTGTTTTTTTAAATAAACC
                                                  Xl3.1-CHK-1012709636       AAATATCAATGCAAGAACTGTCCCAAAACTTCTCTTCGAAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGCTGTGTAGCACATTAGATCGTCATATGTTTACCAGGACTCCACACTTCCCTTCAGGGTTTCTGGTGTAAAAGAATTCCAAACATATATTTCTTACCTCTTTNTTCCTTTCCTATGAAAAGGAAAGCCTATGCAAGATCTACCAAAACGTCAGCATTTCAAGTCTGATTTGCAGTATGGATTACAAATAATAGAAACACTTTTCCGTATGGCAGCAAGGATTAATGAAATGGTCCTTAGATACGCCATATTTCCTTGGCATGAATAAATCAAGCACATATGTAGAGAATGGCTCTTGTCTAGACAATCCAGCAAAAATCCAAAGGACTTTCAGCCTCGTTCTCAGGTGCTTTACTAAGCAGCCCAATGAAATCTTCTCTTCCTGAATTTATAAGACTCTTAAACTATGCCATTGGGTATTGTCATTGTTTTTAGCTAGGCTCCATTTGTGCCTTTTACAGCCATTGCCTTCAGACATTCCTTTGTTTTATTTAAGACTTTTTACAAAAAAAATTTTTATTATAAAATTGACAATTTTGCTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGGGAATGCGAAAATGTAGATCCTGAACTTTTCTTATGCACAAAGAAAATGCAACTTATTTTCGGGATTCTCCACCCTTCATGTGCCTTTTTTTTTATAATAATTTGTAAAATATGTGAATATTGTATATTTTGAAATGTTTATATTTTTCTATATGTGTGAGAATGTGGCGTGTGAAAGAGAGAAGCGGTGTGTAGCTGCTTCAGGGATAACTTGAAGTGATGTGCCAATTTTTTTTGTTTGTTTTTTTAAATAAACCCTATGG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     3     4     3     4     3     4     3     4     3     4     2     2     2     2     2     2
                                                   Xl3.1-xlk162l12ex.3                                                                   TGA------------------------------------ATG---------------------------------------TAA---------------------------------------------------------------------------------------------------------ATG---------TAATAG------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------TAA------------ATGTAG------------------------------------------------------------------------------TAATAA---------------------------------ATG---------------ATG---------------------------------------------------------TGA------------------------------------TAA
  3   1   2      shim Tad1      out                   IMAGE:6879526.3p TGTAAGAAATATCAATGCAAGAACTGTCCCAAAACTTCTCTTCGAAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGCTGTGTAGCACATTAGATCGTCATATGTTTACCAGGACTCCACACTTCCCTTCAGGGTTTCTGGTGTAAAAGAATTCCAAACATATATTTCTTACCTCTTTNTTCCTTTCCTATGAAAAGGAAAGCCTATGCAAGATCTACCAAAACGTCAGCATTTCAAGTCTGATTTGCAGTATGGATTACAAATAATAGAAACACTTTTCCGTATGGCAGCAAGGATTAATGAAATGGTCCTTAGATACGCCATATTTCCTTGGCATGAATAAATCAAGCACATATGTAGAGAATGGCTCTTGTCTAGACAATCCAGCAAAAATCCAAAGGACTTTCAGCCTCGTTCTCAGGTGCTTTACTAAGCAGCCCAATGAAATCTTCTCTTCCTGAATTTATAAGACTCTTAAACTATGCCATTGGGTATTGTCATTGTTTTTAGCTAGGCTCCATTTGTGCCTTTTACAGCCATTGCCTTCAGACATTCCTTTGTTTTATTTAAGACTTTTTACAAAAAAAATTTTTATTATAAAATTGACAATTTTGCTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGGGAATGCGAAAAATGTAGATCCTGAACTTTTCTTATGCACAAAGAAAATGCAACTTATTTTCGGGATTCTCCACCCTTCATGTGCCTTTTTTTTTTATAATAATTTGTAAAATATGTGAATATTGTATATTTTGAGATGTTTATATTTTTCTATATGTGTGAGAATGTGGCGTGTGAAAGAGAGAAGCGGTGGTAGCTGCTTCAGGGATAACTTGAAGTGATGTCCA
  3   1   2       bld Ga18      in                      xlk162l12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCAGGTGCTTTACTAAGCAGCCCAATGAAATCTTCTCTTCCTGAATTTATAAGACTCTTAAACTATGCCATTGGGTATTGTCATTGTTTTTAGCTAGGCTCCATTTGTGCCTTTTACAGCCATTGCCTTCAGACATTCCTTTGTTTTATTTAAGACTTTTTACAAAAAAAAATTTTATTATAAAATTGACAATTTTGCTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGGGAATGCGAAAATGTAGATCCTGAACTTTTCTTATGCACAAAGAAAATGCAACTTATTTTCGGGATTCTCCACCCTTCATGTGCCTTTTTTTTTATAATAATTTGTAAAATATGTGAATATTGTATATTTTGAAATGTTTATATTTTTCTATATGTGTGAGAATGTGGCGTGTGAAAGAGAGAAGCGGTGTGTAGCTGCTTCAGGGATAACTTGAAGTGATGTNCCA
  5   1   2       bld Ga18      in                      xlk162l12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGTGCTTTACTAAGCNGCCCAATGAAATCTTCTCTTCCTGAATTTATAAGACTCTTAAACTATGCCATTGGGTATTGTCATTGTTTTTAGCTAGGCTCCATTTGTGCCTTTTACAGCCATTGCCTTCAGACATTCCTTTGTTTTATTTAAGACTTTTTACaaaaaaaaaTTTTATTATAAAATTGACAATTTTGCTCTCATGGGAATAAGTGCAACCGAGAGGGTTTAAGGGAATGCGAAAATGTAGATCCTGAACTTTTCTTATGCACAAAGAAAATGCAACTTATTTTCGGGATTCTCCACCCTTCATGTGCCtttttttttataataatttgtaaaatatgtgaatattgtatattttgaaatgtttatatttttctatatgtGTGAGAATGTGGCGTGTGAAAGAGAGAAGCGGTGTGTAGCTGCTTCAGGGATAACTTGAAGTGATGTGCCAAttttttttgtttgtttttttAAATAAACCCTATGGATACNNNNAAAAAAA
  3   1   2      seed Neu7                                 XL039c13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTGCTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGGGAATGCGAAAATGTAGATCCTGAACTTTTCTTATGCACAAAGAAAATGCAACTTATTTTCGGGATTCTCCACCCTTCATGTGCCTTTTTTTTTATAATAATTTGTAAAATATGTGAATATTGTATATTTTGAAATGTTTATATTTTTCTATATGTGTGAGAATGTGGCGTGTGAAAGAGAGAAGCGGTGTGTAGCTGCTTCAGGGATAACTTGAAGTGATGTGCCAATTTTTTTTGTTTGTTTTTTTAAATAAACCCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)