Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6861060.5                       2 PI      91          5      978                hypothetical protein LOC432028 [Xenopus laevis]

 This cluster: approximate FL confidence score = 94%

 1012793375 Xl3.1-IMAGE:5156923.5 - 4 ESTs
                                                                       -140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5156923.5                                                                                                                                             TCGGTTAGGAGCTGGCGGAGTGCGGGATAAAGCGTGGAAGGTTTTGTGTGGAGTTTGTTGCGTTGCTGCAGTGAGAGGTCAAAGGCCAAAGGCCAGGTGAAGAATGAATACTATTAAGAACGTGCCGGCCCGGGTTCTTAGTCGGAGGTCCGGCCATGGCTTGGAAGCGGAGAGGGAACAGTTTGACAGGAACCAGGCCGTCAGCATCAGTAAAGCTATCAATACACAGGAAGCTCCAGTGAAAGAGAAACACGCCCGCAGAATTATTTTGGGCACGCATCATGAAAAAGGAGCATTTACATTTTGGTCATATGCCATTGGTCTTCCATTACCTAGCAGTTCTATTCTAAGCTGGAAATTCTGCCATGTCCTGCACAAAGTCCTTCGAGATGGGCATCCAAATGTACTATCTGATTGTCAGCGATACCGCAGTAACATCCGAGAAACAGGAGAGCTATGGGGTCATATGCACGATCGTTATGGGCAGCTTGTGACTATTTATACAAAGCTTTTGCTTAATAAAATAAGCTTTCATGTAAAGCATCCTGAATTTCCACCAGGCTTGGAAGTGACTGATGATGTTCTTGAGAAGTCAGCTGGCACAGATGTCAACAACATATTTCAGCTGACAGTGGAAATGTTTGATTATATGGACTGTGAACTGAAGCTTTCTGAAGCTGTTTTCAGGCAGCTCAATAGTTCCATCGCCGTATCTCAGATGTCCGCAGGACAGTGTAAACTGGCCCCACTTATTCAAGTCATTCAGGATTGCAGTCATCTCTACCATTACACTGTCAAGCTTATGTTTAAGCTCCATTCATGTCTGCCTCCCGATACTCTACAGGGACACAGAGATCGATTTCATGAACAGTTTCATAGTTTAAAAAATTTCTTCAAACGGGCATCAGACATGCTTTACTTCAAGCGACTCATTCAGATCCCCCGTCTTCCTGATGGTCCACCCAACTTTTTGCGAGCTTCTGCCCTTGCTGAGCATGTTAAACCAGTGGTAGTTATTCCCAATGAAACTCCAGAAGATGAGGAACCACCAGAATCTCTGATTGAAATCAGCACAGCTCAGCCTGTGGAGCAAGAGCAGGTTGCGGAAGACCTATTTCAGCAAACATTTGGTCCTCCTAATGGCCTTATGAAAGATGACAGGGACCTTCAAATTGAAAATCTGAAGAAGGAAATAGAATTGCTACATGCTGAACTGGAGAAAATAAAGCTGGAGGCTCAAAAGTACATCTTGCAGCTGAAANGCCAAATCAATACACTGGAGGCTGAGCTGGAGGAACAGAGGAAGCAGAAACAANAGGCTTTAGTAGATATGAACAGTTGCGGGATGAGTTGGAGAAGCTAAAGAAAAGCAACTGTAAA
                                                  Xl3.1-CHK-1012708947                                                                                                                                                   AGGAGCTGGCGGAGTGCGGGATAAAGCGTGGAAGGTTTTGTGTGGAGTTTGTTGCGTTGCTGCAGTGAGAGGTCAAAGGCCAAAGGCCAGGTGAAGAATGAATACTATTAAGAACGTGCCGGCCCGGGTTCTTAGTCGGAGGTCCGGCCATGGCTTGGAAGCGGAGAGGGAACAGTTTGACAGGAACCAGGCCGTCAGCATCAGTAAAGCTATCAATACACAGGAAGCTCCAGTGAAAGAGAAACACGCCCGCAGAATTATTTTGGGCACGCATCATGAAAAAGGAGCATTTACATTTTGGTCATATGCCATTGGTCTTCCATTACCTAGCAGTTCTATTCTAAGCTGGAAATTCTGCCATGTCCTGCACAAAGTCCTTCGAGATGGGCATCCAAATGTACTATCTGATTGTCAGCGATACCGCAGTAACATCCGAGAAACAGGAGAGCTATGGGGTCATATGCACGATCGTTATGGGCAGCTTGTGACTATTTATACAAAGCTTTTGCTTAATAAAATAAGCTTTCATGTAAAGCATCCTGAATTTCCACCAGGCTTGGAAGTGACTGATGATGTTCTTGAGAAGTCAGCTGGCACAGATGTCAACAACATATTTCAGCTGACAGTGGAAATGTTTGATTATATGGACTGTGAACTGAAGCTTTCTGAAGCTGTTTTCAGGCAGCTCAATAGTTCCATCGCCGTATCTCAGATGTCCGCAGGACAGTGTAAACTGGCCCCACTTATTCAAGTCATTCAGGATTGCAGTCATCTCTACCATTACACTGTCAAGCTTATGTTTAAGCTCCATTCATGTCTGCCTCCCGATACTCTACAGGGACACAGAGATCGATTTCATGAACAGTTTCATAGTTTAAAAAATTTCTTCAAACGGGCATCAGACATGCTTTACTTCAAGCGACTCATTCAGATCCCCCGTCTTCCTGATGGTCCACCCAACTTTTTGCGAGCTTCTGCCCTTGCTGAGCATGTTAAACCAGTGGTAGTTATTCCCAATGAAACTCCAGAAGATGAGGAACCACCAGAATCTCTGATTGAAATCAGCACAGCTCAGCCTGTGGAGCAAGAGCAGGTTGCGGAAGACCTATTTCAGCAAACATTTGGTCCTCCTAATGGCCTTATGAAAGATGACAGGGACCTTCAAATTGAAAATCTGAAGAAGGAAATAGAATTGCTACATGCTGAACTGGAGAAAATAAAGCTGGAGGCTCAAAAGTACATCTTGCAGCTGAAANGCCAAATCAATACACTGGAGGCTGAGCTGGAGGAACAGAGGAAGCAGAAACAANAGGCTTTAGTAGATATGAACAGTTGCGGGATGAGTTGGAGAAGCTAAAGAAAAGCAAC
                                                      consensus depths                                                                                                                                                  1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     103     337                                                                                                                                             
                                               BLH MIN      73     278                                                                                                                                             
                                               BLH OVR     103     215                                                                                                                                             
                                               ORF LNG     103      20                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ==== 4e-064     NP_648597.2 CG10971-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 9e-066     NP_741253.1 epsin N-terminal homology and I/LWEQ domain containing protein (104.4 kD)(3J813) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ag ---- 2e-076     XP_001689077.1 AGAP004801-PB [Anopheles gambiae str. PEST] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 3e-085     XP_001189407.1 PREDICTED: similar to huntingtin interacting protein 1 [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED - Bt ---- 3e-127     XP_582283.3 PREDICTED: similar to huntingtin interacting protein 1 [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 3e-165     NP_001077034.1 huntingtin interacting protein 1 related [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 0          XP_543376.2 PREDICTED: similar to Huntingtin interacting protein 1 related (Hip1-related) [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 0          NP_001025828.1 huntingtin interacting protein-1-related [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 0          NP_659507.2 huntingtin interacting protein 1 related [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 0          NP_003950.1 huntingtin interacting protein-1-related; huntingtin interacting protein 12[Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PREDICTED - ?? ---- 0          XP_585048.4 PREDICTED: similar to Huntingtin-interacting protein 1-related protein (Hip1-related) (Hip 12) [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 0          NP_001116907.1 huntingtin interacting protein 1 related [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          NP_001086615.1 huntingtin interacting protein 1 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5156923.5                                                                                                                                                                                                                                              TGA---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------TAA
                                                                   ORF                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2       bld Emb1 5g                         IMAGE:5156923.5p                                                                                                                                             TCGGTTAGGAGCTGGCGGAGTGCGGGATAAAGCGTGGAAGGTTTTGTGTGGAGTTTGTTGCGTTGCTGCAGTGAGAGGTCAAAGGCCAAAGGCCAGGTGAAGAATGAATACTATTAAGAACGTGCCGGCCCGGGTTCTTAGTCGGAGGTCCGGCCATGGCTTGGAAGCGGAGAGGGAACAGTTTGACAGGAACCAGGCCGTCAGCATCAGTAAAGCTATCAATACACAGGAAGCTCCAGTGAAAGAGAAACACGCCCGCAGAATTATTTTGGGCACGCATCATGAAAAAGGAGCATTTACATTTTGGTCATATGCCATTGGTCTTCCATTACCTAGCAGTTCTATTCTAAGCTGGAAATTCTGCCATGTCCTGCACAAAGTCCTTCGAGATGGGCATCCAAATGTACTATCTGATTGTCAGCGATACCGCAGTAACATCCGAGAAACAGGAGAGCTATGGGGTCATATGCACGATCGTTATGGGCAGCTTGTGACTATTTATACAAAGCTTTTGCTTAATAAAATAAGCTTTCATGTAAAGCATCCTGAATTTCCACCAGGCTTGGAAGTGACTGATGATGTTCTTGAGAAGTCAGCTGGCACAGATGTCAACAACATATTTCAGCTGACAGTGGAAATGTTTGATTATATGGACTGTGAACTGAAGCTTTCTGAAGCTGTTTTCAGGCAGCTCAATAGTTTCATCGCCGGTATCTCAGATGTCCGCAGGACAGTGTAAACTGGCCCCCACTTATTCAAGTCATTTCAGGATTGCAGTCATCTCTACCATTACACTGGTCAGCCTTATGGTTTAAGCTCCATTCATGTCTGGCTCCCGATACTCTACGGGGGACACCAGAGGATCGATTTCTTGAACCGGTTTCATAGTTTTAAAAAAATTTCTTTCAAAGGGGCATCAGGAAT
  5   1   2      seed Emb1 5g                         IMAGE:3402412.5p                                                                                                                                                                                                          TTGTTGCGTTGCTGCAGTGAGAGGTCAAAGGCCAGGTGAATAATGAATACTATTAAGAACGTGCCGGCCCGGGTTCTTAGTCGGAGGTCCGGCCATGGCTTGGAAGCGGAGAGGGAACAGTTTGACAGGAACCATGCCGTCAGCATCAGTAAAGCTATCAATACACAGGAAGCTCCAGTGAAAGAGAAACACGCCCGCAGAATTATTTTGGGCACGCATCATGAAAAAGGAGCATTTACATTTTGGTCATATGCCATTGGTCTTCCATTACCTAGCAGTTCTATTCTAAGCTGGAAATTCTGCCATGTCCTGCACAAAGTCCTTCGAGATGGGCATCCAAATGTACTATCTGATTGTCAGCGATACCGCAGTAACATCCGAGAAACAGGAGAGCTATGGGGTCATATGCACGATCGTTATGGGCAGCTTGTGACTATTTATACAAAGCTTTTGCTTAATAAAATAAGCTTTCATGTAAAGCATCCTGAATTTCCACCAGGCTTGGAAGTGACTGATGATGTTCTTGACAAGTCAGCTGGCACAGATGTCAACAACATATTTCAGCTT
  5   1   2      skin Emb1                            IMAGE:5154768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAGCTGGAAATTCTGCCATGTCCTGCACAAAGTCCTTCGAGATGGGCATCCAAATGTACTATCTGATTGTCAGCGATACCGCAGTAACATCCGAGAAACAGGAGAGCTATGGGGTCATATGCACGATCGTTATGGGCAGCTTGTGACTATTTATACAAAGCTTTTGCTTAATAAAATAAGCTTTCATGTAAAGCATCCTGAATTTCCACCAGGCTTGGAAGTGACTGATGATGTTCTTGAGAAGTCAGCTGGCACAGATGTCAACAACATATTTCAGCTGACAGTGGAAATGTTTGATTATATGGACTGTGAACTGAAGCTTTCTGAAGCTGTTTTCAGGCAGCTCAATAGTTCCATCGCCGTATCTCAGATGTCCGCAGGACAGTGTAAACTGGCCCCACTTATTCAAGTCATTCAGGATTGCAGTCATCTCTACCATTACACTGTCAAGCTTATGTTTAAGCTCCATTCATGTCTGCCTCCCGATACTCTACAGGGACACAGAGATCGATTTCATGAACAGTTTCATAGTTTAAAAAATTTCTTCAAACGGGCATCAGACATGCTTTACTTCAAGCGACTCATTCAGATCCCCCGTTCTTCCTGATGGTCCACCCCAACTTTTTGCGAGCTTCTGCCCTTGCTGAGCATGTTAAAACCAGTGGTAGGTATTCCCCAGGAAACTCCAGAAAGATGAGGAAACACCCGGAATCTCTGGATGGAAATCAGCACAGCTCAGCCTGTTGGAGGCAAGAGCAAGGTGGCGGGAAGACCCTAATTTCCGCCAAACATTTGGGGCCTCCCTAAGGGGCCCTTATGGAAAGATGGACAGGGGAACCTTCCAAAATGGAAAATCTGGAAAGAAAGGGAAAATAGGAATC
  5   1   1       add Kid                             IMAGE:7009743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGTTTGATTATATGGACTGTGAACTGAAGCTTTCTGAAGCTGTTTTCAGGCAGCTCAATAGTTCCATCGCCGTATCTCAGATGTCCGCAGGACAGTGTAAACTGGCCCCACTTATTCAAGTCATTCAGGATTGCAGTCATCTCTACCATTACACTGTCAAGCTTATGTTTAAGCTCCATTCATGTCTGCCTCCCGATACTCTACAGGGACACAGAGATCGATTTCATGAACAGTTTCATAGTTTAAAAAATTTCTTCAAACGGGCATCAGACATGCTTTACTTCAAGCGACTCATTCAGATCCCCCGTCTTCCTGATGGTCCACCCAACTTTTTGCGAGCTTCTGCCCTTGCTGAGCATGTTAAACCAGTGGTAGTTATTCCCAATGAAACTCCAGAAGATGAGGAACCACCAGAATCTCTGATTGAAATCAGCACAGCTCAGCCTGTGGAGCAAGAGCAGGTTGCGGAAGACCTATTTCAGCAAACATTTGGTCCTCCTAATGGCCTTATGAAAGATGACAGGGACCTTCAAATTGAAAATCTGAAGAAGGAAATAGAATTGCTACATGCTGAACTGGAGAAAATAAAGCTGGAGGCTCAAAAGTACATCTTGCAGCTGAAANGCCAAATCAATACACTGGAGGCTGAGCTGGAGGAACAGAGGAAGCAGAAACAANAGGCTTTAGTAGATATGAACAGTTGCGGGATGAGTTGGAGAAGCTAAAGAAAAGCAACTGTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)