Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL499i24ex.3                          5 END     1          20       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL199o03.5.5                         12 PI      83        322      662                LIM homeobox 1 [Xenopus tropicalis]
     3   0.0    0Xl3.1-xlk126l20ex.5                         4 PI      73        322      651                LIM homeobox 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 91%

 1012793552 Xl3.1-IMAGE:6637447.5 - 5 ESTs
                                                                       .......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6637447.5                                                                                                                                                                                                                                                        GGCACAGAGGTGGAACGGGAGAAAGTGACATCTAGGATTGTGGAGTAGGACACCCTCCCTAGCAGATTGGTTTGGGGATCACTGCCGGAACGTTGGAGCATGTGGGAATAAATGACAATATTGGCCACCTGTCATCTGAGCTATCCACAGAGTCAGTATTGGTGAAAACAGGCGCCCCCCTAGGACTGTGCCAGGGACACTTGCGTACAAGGCCCGCTGGGACTGAACTTATATTTGGGTCTTTGGTTGGGGAGTCTATGAGGATTTCACTGGAGTTGGCTTCTGCTGCAGCTGTTTCTTCCAACCATGATGGCCCATTGCGCTGGGTGTGAGAGGCCCATCCTGGACCGATTTCTTCTTAATGTCCTGGACAGAGCCTGGCATGTCAAATGTGTGCAGTGCTGTGAGTGCAAGTGCAACCTGACCGAAAAGTGCTTCTCCAGGGAGGGCAAGCTCTACTGCAAAACTGACTTCTTCAGGAGATTTGGCACCAAATGTGCAGGATGCTCCCTTGGGATCTCTCCAAGTGACTTGGTCAGGAAAGCGAGGAATAAGGTGTTTCACCTGAACTGTTTCACCTGCATGGTGTGCAATAAGCAGCTCTCAACAGGCGAGGAACTCTACATCATAGATGAAAACAAATTTGTCTGCAAAGAGGATTATACCAGTGTCAGCAGTCTGAAGGAAAGCAGCCTCAACTCAGTGTCTTCTTGCACAGACAGAAGTTTGTCTCCAGACCTCCAAGACCCCATAAAGGATGAGAGCAAAGAGACAGACCACTCCACATCTTCAGACAAAGAAACGACTAACAATGAGAATGAAGAACAGAACTCTGGTACT
                                                  Xl3.1-CHK-1012704375                                                                                                                                                                                                                                                              GAGGTGGAACGGGAGAAAGTGACATCTAGGATTGTGGAGTAGGACACCCTCCCTAGCAGATTGGTTTGGGGATCACTGCCGGAACGTTGGAGCATGTGGGAATAAATGACAATATTGGCCACCTGTCATCTGAGCTATCCACAGAGTCAGTATTGGTGAAAACAGGCGCCCCCCTAGGACTGTGCCAGGGACACTTGCGTACAAGGCCCGCTGGGACTGAACTTATATTTGGGTCTTTGGTTGGGGAGTCTATGAGGATTTCACTGGAGTTGGCTTCTGCTGCAGCTGTTTCTTCCAACCATGATGGCCCATTGCGCTGGGTGTGAGAGGCCCATCCTGGACCGATTTCTTCTTAATGTCCTGGACAGAGCCTGGCATGTCAAATGTGTGCAGTGCTGTGAGTGCAAGTGCAACCTGACCGAAAAGTGCTTCTCCAGGGAGGGCAAGCTCTACTGCAAAACTGACTTCTTCAGGAGATTTGGCACCAAATGTGCAGGATGCTCCCTTGGGATCTCTCCAAGTGACTTGGTCAGGAAAGCGAGGAATAAGGTGTTTCACCTGAACTGTTTCACCTGCATGGTGTGCAATAAGCAGCTCTCAACAGGCGAGGAACTCTACATCATAGATGAAAACAAATTTGTCTGCAAAGAGGATTATACCAGTGTCAGCAGTCTGAAGGAAAGCAGCCTCAACTCAGTGTCTTCTTGCACAGACAGAAGTTTGTCTCCAGACCTCCAAGACCCCATAAAGGATGAGAGCAAAGAGACAGACCACTCCACATCTTCAGACAAAGAAACGACTAACAATGAGAATGAAGAACAGAACTCTGGTACTAAAAGA
                                                      consensus depths                                                                                                                                                                                                                                                             2     2     2     2     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     3     4     3     4     3     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     5     4     5     3     5     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     2     3     3     3     3     3     2     3     2     3
                                               BLH ATG     306     182                                                                                                                                                                                                                                                        
                                               BLH MIN     306     109                                                                                                                                                                                                                                                        
                                               BLH OVR     306     363                                                                                                                                                                                                                                                        
                                               ORF LNG     306       8                                                                                                                                                                                                                                                        
  5   1   1       add Emb1                            IMAGE:6865745.5p ATCCCCAAGAAGAATACCCTCTACTTTGTAACCAGAATGAACTCTTAGCAGCATCTCTCCTCCAAGCTACCCCCGTGCCAGGGACCATTCTCCAGCGTCCAGCCAATATAGATGTGCTATAAATTACCCGGTAACCATGGCTACTCCGCGCTGATTGGCAGATTGCTTGGCGACGTTGCTGGGGACGTCACGAAATCTGAATAAGGATGCGCGAATTGCCAAGCTTGGCACTCAGAGCCGATTATGGGGCACAGAGGTGGAACGGGAGAAAGTGACATCTAGGATTGTGGAGTAGGACACCCTCCCTAGCAGATTGGTTTGGGGATCACTGCCGGAACGTTGGAGCATGTGGGAATAAATGANAATATTGGCCACCTGTCACCTGAGCTATCCACAGAGTTAATATTGGTGAAAACAGGCGCCCCCCTAGGACTGTGCCAGGGACATTTGCGTACAAGGCCCGCTGGGACTCCAGGTAATATTTGGGTCTTTTGGTTGGGGGAGTCTTATGAGGGATTTCACTGGACTTGGGCTTCCTGCTTGCCAGCTGGTTTTCTTCCAACCCATGGATGGCCCCATTTGCCCCTGGGGGGGTAAAAAGGGCCCATCCCGGGGACCCGAATTTTCTTCCTTAAAGGGGCCGGGGAAAAAAACCCCGGGGCAGGGTCAAAAATGTGTTGCCAAGTGCTTTTTGAATTGGCCAAATTGCCAACCCTGGACCCGAAAAAAAGTGCTTTCTCTCCCgggggaggggggaaagactctttactgggcaaaaaactgggacttttttttCCAGGGAAAATTTTGTGGGCCCCCAACAATTGTGGCCCAAGAAGAGCCCCTCCCCCCGTGGGGGGAACTCTCTCTCCCCACAGGTGAATCTTTGGGCGTCCCGGGAAAAAAACCCCGGAGGAAATAAAN
  5   1   2       bld Ga15 5g3  out                      XL499i24ex.5p                                                                                                                                                                                                                                                        GGCACAGAGGTGGAACGGGAGAAAGTGACATCTAGGATTGTGGAGTAGGACACCCTCCCTAGCAGATTGGTTTGGGGATCACTGCCGGAACGTTGGAGCATGTGGGAATAAATGACAATATTGGCCACCTGTCATCTGAGCTATCCACAGAGTCAGTATTGGTGAAAACAGGCGCCCCCCTAGGACTGTGCCAGGGACACTTGCGTACAAGGCCCGCTGGGACTGAACTTATATTTGGGTCTTTGGTTGGGGAGTCTATGAGGATTTCACTGGAGTTGGCTTCTGCTGCAGCTGTTTCTTCCAACCATGATGGCCCATTGCGCTGGGTGTGAGAGGCCCATCCTGGACCGATTTCTTCTTAATGTCCTGGACAGAGCCTGGCATGTCAAATGTGTGCAGTGCTGTGAGTGCAAGTGCAACCTGACCGAAAAGTGCTTCTCCAGGGAGGGCAAGCTCTACTGCAAAACTGACTTCTTCAGGAGATTTGGCACCAAATGTGCAGGATGCTCCCTTGGGATCTCTCCAAGTGACTTGGTCAGGAAAGCGAGGAATAAGGTGTTTCACCTGAACTGTTTCACCTGCATGGTGTGCAATAAGCAGCTCTCAACAGGCGAGGAACTCTACATCATANATGAAAACAAATTTGTCTGCAAAGAGGATTATATCANTGCCAGCAGTCTGA
  5   1   1       add Emb1 5g                         IMAGE:6862884.5p                                                                                                                                                                                                                                                                       GGCACAGAGGTGGAACGGGAGAAAGTGACATCTAGGATACAGAAGAAGGACACCCCAAGCAGCCTGTGTTTTTTGGGATCAGCGGAACGTGGAGCATGTGGGAATAAAACATAATACTGGGCACCTGTCATCTGAACTATCCACAGAGACAATACCAGGCGCCCCCCCTTGGACTGTGCCAGGGACCCTTGCGAACAGGGCTGGGACTGAATTCACACTTTTGGGTGTTTGGTTGAGGGTCTATGAGGATTTCACTGGAGTGGGCTTCTGCTGCCGGTGTTTGCTTCAATCATGATGGCCCATTGCGCTGGGTGTGAGAGGCCCATCTTGGACCGATTTCTCCTTAATGTCCTGGACAGAGCCTGGCATGTCAAATGTGTGCAGTGCTGTGAGTGCAAGTGCAATCTGACCGAAAAGTGCTTCTCCAGGGACAGTAAACTCTACTGCAAAACTGACTTTTTCAGGAGATTTGGTACAAAATGTGCAGGATGCTCCCTGGGGATCTCTCCAAGTGACTTGGTCAGGANAGCGAGGAATAAAGTGTTTCACCTGAACTGTTTCACCTGCATGGTGTGNCATAAGCAGCTCTCAACAGGCGAGGAACTCTACATCATAGATGAAAACAAATTTGTCTGCAAAGAGGATTATACCAGTGTCAGCAGTCTGAAGGAAAGCAGCCTCAACTCAGTGTCTTCTTGCACAGACAGAAGTTTGTCTCCAGACCTCCAAGACCCCCTAAAAGATGAGAGCAAAGAGACAGACCACTCCACATCTTTCGACAAAGAAACGACTAACAATGAGGAATGAAGAACAAGAACTCGTGGTACTAAAAGAAAGGGGACCACGGAACGAACTATTTAAGGCCAAGCCAACTTGGG
  5   1   2      seed Emb1 5g                         IMAGE:6637447.5p                                                                                                                                                                                                                                                                                                    GTAGGACACCCTCCCTAGCAGATTGGTTTGGGGATCACTGCCGGAACGTTGGAGCATGTGGGAATAAATGACAATATTGGCCACCTGTCATCTGAGCTATCCACAGAGTCAGTATTGGTGAAAACAGGCGCCCCCCTAGGACTGTGCCAGGGACACTTGCGTACAAGGCCCGCTGGGACTGAACTTATATTTGGGTCTTTGGTTGGGGAGTCTATGAGGATTTCACTGGAGTTGGCTTCTGCTGCAGCTGTTTCTTCCAACCATGATGGCCCATTGCGCTGGGTGTGAGAGGCCCATCCTGGACCGATTTCTTCTTAATGTCCTGGACAGAGCCTGGCATGTCAAATGTGTGCAGTGCTGTGAGTGCAAGTGCAACCTGACCGAAAAGTGCTTCTCCAGGGAGGGCAAGCTCTACTGCAAAACTGACTTCTTCAGGAGATTTGGCACCAAATGTGCAGGATGCTCCCTTGGGATCTCTCCAAGTGACTTGGTCAGGAAAGCGAGGAATAAGGTGTTTCACCTGAACTGTTTCACCTGCATGGTGTGCAATAAGCAGCTCTCAACAGGCGAGGAACTCTACATCATAGATGAAAACAAATTTGTCTGCAAAGAGGATTATATCAGTGCCAGCAGTCTGAAGGAAAGCAGCCTCAACTCAGTGTCTTCTTGCACAGACAGAAGTTTGTCTCCAGATATCCAAGAACCTATACAGGATGAGAGCAAAGAGACAGACCCCTCCACATCTTCGGACAAAGAGACAGCTAACAATGAGAATGAGGAACAGAACTCTGGTACTAAAAGAAAGGGGACCCCGGGACAACTATTAAGGCCCCAGCAACTGGNAGACCCTTAAGGCTGCCTTTTATTGCCACCCCCCTAGCCCCA
  5   1   1       add Emb1                            IMAGE:6863040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGAATANAGTGTTTCACCTGAACTGTTTCACCTGCATGGTGTGCAATAAGCAGCTCTCAACAGGCGAGGAACTCTACATCATAGATGAAAAACAAATTTGTCTGCAAAGAGGATTATACCAGTGTCAGCAGTCTGAAGGAAAGCAGCCTCAACTCAGTGTCTTCTTGCACAGACAGAAGTTTGTCTCCAGACCTCCAAGACCCCATAAAGGATGAGAGCAAAGAGACAGACCACTCCACATCTTCAGACAAAGAAACGACTAACAATGAGAATGAAGAACAGAACTCTGGTACTAAAAGAAGGGGACCACGGACGACTATTAAGGCCAAGCAACTGGAGACCCTTAAGGCTGCTTTTGCTGCCACTCCTAAGCCCACCAGGCATATTCGGGAACAGCTAGCTCAGGAAACAGGGCTAAACATGCGGGTGATTCAGGTTTGGTTCCAAAACCGAAGATCCAAAGAAAGGAGGATGAAGCAGCTCAGCGCTTTGGGGGCCAGGAGGCATGCTTTTTTCAGGAGTCCAAGGCGTATGCGACCCCTGGGAGGAAGGCTGGATGAGTCTGACATCCTGAACTCTGGGCCTTACAGCTACTACGGAGATTATCAAGGAGATTATTATGGAAGTGGAAATTATGACTTTTTTCCTCATGGACCACCATCTTCCCAGACACAGTCCCCAGCAGACTCTAGCTACCTACAGAATTCTGGACCTGGTTCAACTCCTTTAGGTCCTTTAGAATCTCAGCTTTCTGGACACCACCCTTCGGAAAACCAAAGATATGCGGGACATGATTTCCCATCCTGACACTCCCAGTCCTGAGCCGGGTATGACTGGCTCCCTCCATTCATTTCTGGTGGAGTCTTCAGTGGTGGTCTAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)