Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL060h14.5                            2 END     2          50      100                transforming growth factor-beta 5 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012793641 Xl3.1-XL060h14.3 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL060h14.3 GGCATGGTACAGAACCCACAAACCACCTTACTGCTTTAACCAGTGTCGAAGAAGGAGACCATGTAGTCAAGTCATGAAGATTGATGAACCTGTTAATTCTACATCTGAAAAGAGCAAATGCTGAAAGCAGTTAGTAACTTCCCAGCCCACACATGGATTTAGGATTCTTCTACAGCAATACACCTTTGGTTACAATATCTGTATTCCTGCACTTCGCACCTCAGTTACTGTATCAAGTTTTTAGCTCTCTGCTACAGCTTTTATGAAAGTGCTTCCTTGCCAAAGGTTATGGACAAATGTTAAGTTTTGGCAACAGCAAAATCTGGGTTCAAGGTAAAGTCACTCATCTGAAAGCATCCAGTCCATGTAAAGGGGTTTTACATGGACTGGATAATACAGTTGTTATGGCAGAGAAATAAGGGATGTACCCCATGATAAATAAACAGAAGGCCAGCTAACAAGAGACAGACAAAAAAGCAGAAACCCCTTCTAGAATTTGTTTGGTGGCTATTCCATTATTTTTATGGCAAGCTAAAGACTAATCCACATTCAAAAAATGCTGACAAGAATGCCTTACAGAGAAGTTAACCCACTCAATGCTGAGCACAGATTGGAGAATCACAAGGCTCTTTATAGATTGTGTATTTATTAACATATATAATTGCCACATAAAAGCTCAAGCATTTCGTATTAGACATATTAATGATAAAAAAATATTCACAACTGTTTTTGATAAAACATGGGGGTTCCCATGTTCATTTCTACTATCCCAACTTGTAGAGCTGTGAATGTGTTTAAAAGGAAACAAAGACAATGATTTACAAATCCAGAATATAGGAATCAATCAGAAAAAGAAAACATATGACTCTGCTGCAGGACTGACCTGTCAGATATAACTGGATGAAATACAGAAAGCCATGTGCAGGTACCCACTGAACAAAGAAGGGGCTAATAATTCCTGTTTAAATGAGAAGGGTTTTTTTTTTTTACCTTTTTAAATGGTCTTATTTTATATAGTTTTTTTTTTAATATTTAAAAGGTTTTGTTTTAATGAGGAAAAATAAAAAAGGTACATACAAA
                                                  Xl3.1-CHK-1012707287       GTACAGAACCCACAAACCACCTTACTGCTTTAACCAGTGTCGAAGAAGGAGACCATGTAGTCAAGTCATGAAGATTGATGAACCTGTTAATTCTACATCTGAAAAGAGCAAATGCTGAAAGCAGTTAGTAACTTCCCAGCCCACACATGGATTTAGGATTCTTCTACAGCAATACACCTTTGGTTACAATATCTGTATTCCTGCACTTCGCACCTCAGTTACTGTATCAAGTTTTTAGCTCTCTGCTACAGCTTTTATGAAAGTGCTTCCTTGCCAAAGGTTATGGACAAATGTTAAGTTTTGGCAACAGCAAAATCTGGGTTCAAGGTAAAGTCACTCATCTGAAAGCATCCAGTCCATGTAAAGGGGTTTTACATGGACTGGATAATACAGTTGTTATGGCAGAGAAATAAGGGATGTACCCCATGATAAATAAACAGAAGGCCAGCTAACAAGAGACAGACAAAAAAGCAGAAACCCCTTCTAGAATTTGTTTGGTGGCTATTCCATTATTTTTATGGCAAGCTAAAGACTAATCCACATTCAAAAAATGCTGACAAGAATGCCTTACAGAGAAGTTAACCCACTCAATGCTGAGCACAGATTGGAGAATCACAAGGCTCTTTATAGATTGTGTATTTATTAACATATATAATTGCCACATAAAAGCTCAAGCATTTCGTATTAGACATATTAATGATAAAAAAATATTCACAACTGTTTTTGATAAAACATGGGGGTTCCCATGTTCATTTCTACTATCCCAACTTGTAGAGCTGTGAATGTGTTTAAAAGGAAACAAAGACAATGATTTACAAATCCAGAATATAGGAATCAATCAGAAAAAGAAAACATATGACTCTGCTGCAGGACTGACCTGTCAGATATAACTGGATGAAATACAGAAAGCCATGTGCAGGTACCCACTGAACAAAGAAGGGGCTAATAATTCCTGTTTAAATGAGAAGGGTTTTTTTTTTTTACCTTTTTAAATGGTCTTATTTTATATAGTTTTTTTTTTAATATTTAAAAGGTTTTGTTTTAATGAGGAAAAATAAAAAAGGTACA
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     3     1     3     1     3     1     3     1     2     1     2     2     2     1     1
                                                      Xl3.1-XL060h14.3                                                                           TGA------ATG---------------------------------------------TAGTAA---------------ATG------------------------------------------------------------------------------------------------------------TGA------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------TAA---ATG------ATG---------------------TAA---------------------------------------------------------------------------------TAA------------------TGA---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATG------------------------------------------------------------------------------------------------------TAA---------------------ATG---------------------------------------------------------------------------TAAATG------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                        ]
  5   1   2       bld Tad2                            IMAGE:6935360.5p GGCATGGTACAGAACCCACAAACCACCTTACTGCTTTAACCAGTGTCGAAGAAGGAGACCATGTAGTCAAGTCATGAAGATTGATGAACCTGTTAATTCTACATCTGAAAAGAGCAAATGCTGAAAGCAGTTAGTAACTTCCCAGCCCACACATGGATTTAGGATTCTTCTACAGCAATACACCTTTGGTTACAATATCTGTATTCCTGCACTTCGCACCTCAGTTACTGTATCAAGTTTTTAGCTCTCTGCTACAGCTTTTATGAAAGTGCTTCCTTGCCAAAGGTTATGGACAAATGTTAAGTTTTGGCAACAGCAAAATCTGGGTTCAAGGTAAAGTCACTCATCTGAAAGCATCCAGTCCATGTAAAGGGGTTTTACATGGACTGGATAATACAGTTGTTATGGCAGAGAAATAAGGGATGTACCCCATGATAAATAAACAGAAGGCCAGCTAACAAGAGACAGACAAAAAAGCAGAAACCCCTTCTAGAATTTGTTTGGTGGCTATTCCATTATTTTTATGGCAAGCTAAAGACTAATCCACATTCAAAAAATGCTGACAAGAATGCCTTACAGAGAAGTTAACCCACTCAATGCTGAGCACAGATTGGAGAATCACAAAGCTCTTTATAGATTGTGTATTTATTAACATATATAATTGCCACATAAAAGCTCAAGCATTTTCGTATTAGACATATTTAATGATAAAAAAATTATTCACAACTGTTTT
  3   1   2       bld Tbd7      out                        XL060h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACAAAAAAGCAGAAACCCCTTCTAGAATTTGTTTGGTGGCTATTCCATTATTTTTATGGCAAGCTAAAGACTAATCCACATTCAAAAAATGCTGACAAGAATGCCTTACANAGAAGTTAACCCACTCAATGCTGAGCACAGATTGGAGAATCACAAGGCTCTTTATAGATTGTGTATTTATTAACATATATAATTGCCACATAAAAGCTCAAGCATTTCGTATTAGACATATTAATGATAAAAAAATATTCACAACTGTTTTTGATAAAACATGGGGGTTCCCATGTTCATTTCTACTATCCCAACTTGTAGAGCTGTGAATGTGTTTAAAAGGAAACAAAGACAATGATTTACAAATCCAGAATATAGGAATCAATCAGAAAAAGAAAACATATGACTCTGCTGCAGGACTGACCCGTCAGATATAACTGGATGAAATACAGAAAGCCATGTGCAGGTACCCNCTGAACAAAGAAGGGGCTAATAATTCCTGTTTAAATGAGAAGGGTTTTTTTTTTACCTTTTTAAAnGGTCTTATTTTATATAGGTTTTTTTTTAATATTTAAAAGGTTT
  3   1   2      seed Oo1       out                   IMAGE:3403609.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAATGCCTTACAGAGAAGTTAACCCACTCAATGCTGAGCACAGATTGGAGAATCACAAGGCTCTTTATAGATTGTGTATTTATTAACATATATAATTGCCACATAAAAGCTCAAGCATTTCGTATTAGACATATTAATGATAAAAAAATATTCACAACTGTTTTTGATAAAACATGGGGGTTCCCATGTTCATTTCTACTATCCCAACTTGTAGAGCTGTGAATGTGTTTAAAAGGAAACAAAGACAATGATTTACAAATCCAGAATATAGGAATCAATCAGAAAAAGAAAACATATGACTCTGCTGCAGGACTGACCTGTCAGATATAACTGGATGAAATACAGAAAGCCATGTGCAGGTACCCACTGAACAAAGAAGGGGCTAATAATTCCTGTTTAAATGAGAAGGGTTTTTTTTTTTACCTTTTTAAATGGTCTTATTTTATATAGTTTTTTTTTTAATATTTAAAAGGTTTTGTTTTAATGAGGAAAAATAAAAAAGGTACATACA
  3   1   2       bld Tbd1                                 AW782608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTCAATGCTGAGCACAGATTGGAGAATCACAAGGCTCTTTATAGATTGTGTATTTATTAACATATATAATTGCCACATAAAAGCTCAAGCATTTCGTATTAGACATATTAATGATAAAAAAATATTCACAACTGTTTTTGATAAAACATGGGGGTTCCCATGTTCATTTCTACTATCCCAACTTGTAGAGCTGTGAATGTGTTTAAAAGGAAACAAAGACAATGATTTACAAATCCAGAATATAGGAATCAATCAGAAAAAGAAAACATATGACTCTGCTGCAGGACTGACCTGTCAGATATAACTGGATGAAATACAGAAAGCCATGTGCAGGTACCCACTGAACAAAGAAGGGGCTAATAATTCCTGTTTAAATGAGAAGGGTTTTTTTTTTTTACCTTTTTAAATGGTCTTATTTTATATAGTTTTTTTTTTAATATTTAAAAGGTTTTGTTTTAATGAGGAAAAATAAAAAAGGTACATACAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)