Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 89%

 1012793666 Xl3.1-IMAGE:6641448.5 - 3 ESTs
                                                                       ......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6641448.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGATGCTGTGAGAAAGACAGTGACAGTGAAGATGGTGTCTTGGATCATCTCCCGTGCTGTGGTGCTTGTCTTTGGTTTGCTGTACCCTGCATATGCCTCATACAAAGCTGTGAAGACAAAGAATGTTCGGGACTATGTGCGTTGGATGATGTATTGGATTGTATTTGCTCTTTTTATGACTGTAGAAACATTTACAGACATTTTTATTGCCTGGTTCCCCTTTTACTATGAGATTAAGATGGCCTTTGTGGTATGGCTTTTGTCCCCGTACACAAGAGGAGCCAGCCTTCTGTATAGGAAGTGTATTCATCCTACTCTGTCCTTGAAGGAGAAGGAGATCGATTCCTACATTATACAGGCAAAAGAACGAAGTTACGAGTCGTTTGTGAACATTGGGCGCAAAGGTCTAAACATAGCAGCCAGTGCGGCAGTGCAAGCTGCTACCAAGGGTCAGGGAGCGTTAGTGGGGAGGCTGAGGAGTTTCAGTATGCAGGACTTGCGTGCTCTTCCCGACGACACCCCTATACACTACACTGATGCCCTGTATCCTGATGAACCTCAACTGCACCGCAGGCCAATGGGGTTCCCAACCACCTCTCAAGCTGATAGTGACTCTATGGATGAACGGTGGTCAGATTCTGAAATTGCTGAAACAAGGACGGCAGCTAGGACAAGGGGAGGCATGCCATCTAAATCACTACAGAGGAGCCAGAGTCTGCGGGTTTCCAAGAAGAAGGGGCTGAGTCGAGAGGTCTCTACAAAAACAACCAAACCCAGAGCAAAGAAGAAAGCCTGCCCCATCAAACCTGAAAACTCTAATATGGGGGTCTCATTTGACTGGGACTTGAGGGAAANTGCTGTAACTTCTTCCTATGCTGAATTTTTATACCTGAATTTTTTATGGGATGGAG
                                                  Xl3.1-CHK-1012710958                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTGAGAAAGACAGTGACAGTGAAGATGGTGTCTTGGATCATCTCCCGTGCTGTGGTGCTTGTCTTTGGTTTGCTGTACCCTGCATATGCCTCATACAAAGCTGTGAAGACAAAGAATGTTCGGGACTATGTGCGTTGGATGATGTATTGGATTGTATTTGCTCTTTTTATGACTGTAGAAACATTTACAGACATTTTTATTGCCTGGTTCCCCTTTTACTATGAGATTAAGATGGCCTTTGTGGTATGGCTTTTGTCCCCGTACACAAGAGGAGCCAGCCTTCTGTATAGGAAGTGTATTCATCCTACTCTGTCCTTGAAGGAGAAGGAGATCGATTCCTACATTATACAGGCAAAAGAACGAAGTTACGAGTCGTTTGTGAACATTGGGCGCAAAGGTCTAAACATAGCAGCCAGTGCGGCAGTGCAAGCTGCTACCAAGGGTCAGGGAGCGTTAGTGGGGAGGCTGAGGAGTTTCAGTATGCAGGACTTGCGTGCTCTTCCCGACGACACCCCTATACACTACACTGATGCCCTGTATCCTGATGAACCTCAACTGCACCGCAGGCCAATGGGGTTCCCAACCACCTCTCAAGCTGATAGTGACTCTATGGATGAACGGTGGTCAGATTCTGAAATTGCTGAAACAAGGACGGCAGCTAGGACAAGGGGAGGCATGCCATCTAAATCACTACAGAGGAGCCAGAGTCTGCGGGTTTCCAAGAAGAAGGGGCTGAGTCGAGAGGTCTCTACAAAAACAACCAAACCCAGAGCAAAGAAGAAAGCCTGCCCCATCAxAxCxxAAAACTxxxATxTGGGGGTCTCATTTGACTGGGACTTGAGGGAAANTGCTGTAACTTCTTxxxAxxCTGAATxxxxAxACCTGAATTTTTTATGGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      1     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2
                                               BLH ATG      32     478                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN      29     105                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Ce ==== 1e-042     NP_497221.1 DNA segment Chr (3B236) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 2e-047     NP_001097425.1 CG30193 CG30193-PG, isoform G [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 2e-051     XP_001180815.1 PREDICTED: similar to receptor expression enhancing protein 2 [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Ag ---- 3e-052     XP_309319.4 AGAP011331-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 4e-071     XP_421536.2 PREDICTED: similar to Receptor accessory protein 3 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Dr ==== 5e-071     NP_956455.1 hypothetical protein MGC55529 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Mm ==== 3e-088     NP_850919.1 RIKEN cDNA 2700029E10 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Hs ==== 2e-088     NP_079508.2 hypothetical protein FLJ22246 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PREDICTED - Cf ---- 2e-091     XP_543255.2 PREDICTED: similar to receptor expression enhancing protein 4 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Bt ==== 1e-092     NP_001029705.1 hypothetical protein LOC519613 [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 4e-140     CAJ83633.1 novel protein TB2/DP1, HVA22 family protein (ortholog of human open reading frame 20, C8orf20) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 2e-145     NP_001086898.1 MGC84659 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6641448.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------------------------------------------------------------------ATGATG------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  5   1   2      seed Oo1  5g                         IMAGE:6641448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGATGCTGTGAGAAAGACAGTGACAGTGAAGATGGTGTCTTGGATCATCTCCCGTGCTGTGGTGCTTGTCTTTGGTTTGCTGTACCCTGCATATGCCTCATACAAAGCTGTGAAGACAAAGAATGTTCGGGACTATGTGCGTTGGATGATGTATTGGATTGTATTTGCTCTTTTTATGACTGTAGAAACATTTACAGACATTTTTATTGCCTGGTTCCCCTTTTACTATGAGATTAAGATGGCCTTTGTGGTATGGCTTTTGTCCCCGTACACAAGAGGAGCCAGCCTTCTGTATAGGAAGTGTATTCATCCTACTCTGTCCTTGAAGGAGAAGGAGATCGATTCCTACATTATACAGGCAAAAGAACGAAGTTACGAGTCGTTTGTGAACATTGGGCGCAAAGGTCTAAACATAGCAGCCAGTGCGGCAGTGCAAGCTGCTACCAAGGGTCAGGGAGCGTTAGTGGGGAGGCTGAGGAGTTTCAGTATGCAGGACTTGCGTGCTCTTCCCGACGACACCCCTATACACTACACTGATGCCCTGTATCCTGATGAACCTCAACTGCACCGCAGGCCAATGGGGTTCCCAACCACCTCTCAAGCTGATAGTGACTCTATGGATGAACGGTGGTCAGATTCTGAAATTGCTGAAACAAGGACGGCAGCTAGGACAAGGGGAGGCATGCCATCTAAATCACTACAGAGGAGCCAGAGTCTGCGGGTTTCCAAGAAGAAGGGGCTGAGTCGAGAGGTCTCTACAAAAACAACCAAACCCAGAGCAAAGAAGAAAGCCTGCCCCATCAGAACCTGNAAAACTAATATGGGGGTCTCATTTGACTGGGACTTGAGGGAAANTGCTGTAACTTCTTCCTATGNAAGGCAAAAACACCTGAATTTTTTATGGGATGGAGCGC
  5   1   2       bld Oo1  5g                         IMAGE:5078371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCTGTGAGAAAGACAGTGACAGTGAAGATGGTGTCTTGGATCATCTCCCGTGCTGTGGTGCTTGTCTTTGGTTTGCTGTACCCTGCATATGCCTCATACAAAGCTGTGAAGACAAAGAATGTTCGGGACTATGTGCGTTGGATGATGTATTGGATTGTATTTGCTCTTTTTATGACTGTAGAAACATTTACAGACATTTTTATTGCCTGGTTCCCCTTTTACTATGAGATTAAGATGGCCTTTGTGGTATGGCTTTTGTCCCCGTACACAAGAGGAGCCAGCCTTCTGTATAGGAAG
  5   1   2       bld Oo1  5g                         IMAGE:6862296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAAGACAGTGACAGTGAAGATGGTGTCTTGGATCATCTCCCGTGCTGTGGTGCTTGTCTTTGGTTTGCTGTACCCTGCATATGCCTCATACAAAGCTGTGAAGACAAAGAATGTTCGGGACTATGTGCGTTGGATGATGTATTGGATTGTATTTGCTCTTTTTATGACTGTAGAAACATTTACAGACATTTTTATTGCCTGGTTCCCCTTTTACTATGAGATTAAGATGGCCTTTGTGGTATGGCTTTTGTCCCCGTACACAAGAGGAGCCAGCCTTCTGTATAGGAAGTGTATTCATCCTACTCTGTCCTTGAAGGAGAAGGAGATCGATTCCTACATTATACAGGCAAAAGAACGAAGTTACGAGTCGTTTGTGAACATTGGGCGCAAAGGTCTAAACATAGCAGCCAGTGCGGCAGTGCAAGCTGCTACCAAGGGTCAGGGAGCGTTAGTGGGGAGGCTGAGGAGTTTCAGTATGCAGGACTTGCGTGCTCTTCCCGACGACACCCCTATACACTACACTGATGCCCTGTATCCTGATGAACCTCAACTGCACCGCAGGCCAATGGGGTTCCCAACCACCTCTCAAGCTGATAGTGACTCTATGGATGAACGCTGGTCAGATTCTGAAATTGCTGAAACAAGGACGGCAGCTAGGACAAGGGGAGGCATGCCATCTAAATCACTACAGAGGAGCCAGAGTCTGCGGGTTTCCAAGAAGAAGGNGCTGAGTCGAGAGGTCTCTACTAAAACAACCAAACCCAGAGCANAGAAGAAGCTTGCCCAATCAGAACCTGAAAACTAATATGGGGTCTCATTGACTGACTTGAGGGAATGCTNGTACTCTTCTATGAAGCAAAACACTGAATTTTTATGGATGAGCGGATGTCCCCACTGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)