Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012793772 Xl3.1-IMAGE:7768006.5 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7768006.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATACTCGTATATTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGTTGTGATGAAGGAGCTTCAACTAAAGCCTCCACTGATCATAATTTGGCAAGGCAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACGGCAAGAGAAGGAAGAGTTCCAGAAATTACAGAAACTATTTGGATTAGACAACTCTGGAGGTTACAGGCAGCAATCCCTACAGAATATGGAAAGAGCAGTGGGAAGGGGAAGGATGCAACCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAATCTTTGGCTACTGGTGTGGATGATGGAAGAACAAAGACTTCAGGTGTTATAGAAGTTCTGACTAAATATTATCATAGTGCAGCCCATGAAGTTAGTCGAGTTTGGCTTTGCTCTCAGTTAGACCACTTCAGCAACTCTTCAGGAGATAAAGGTTGGGGCTGTGGCTTCCGAAATTTCCAGATGGTTCTTTCTTCCCTTTTGCTAAATGAAACTTACAATAACTGCTTGCAAGCTTATAGATCAATACCCTGTATTCCAAAAATACAGTGTATGATTGAAGATGCATGGAAGGAAGGTTTTGATCCCCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATCTACGGTTTGCTGACATCCCTCGATATAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTCCGTCAGGAACACATCCTCTGTTATTTAACTGGGTGCTGAATTATTATGCTTCGGAGGGGACTGGAGTTGGCAAAGTGGTCTGTACTTCCAAGATGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAACGAAAGAATAAAACCTTGTGTCTTTTAATCTTTGATCCTGGATGCTCATCTGAAAATATGCAAAAGCTATTAAAACAGAATGTAGATGGTGCTTCTCTTAAAGGGCTGCGAAAATTTGTGGGGAGTTTGAAGCACAAGCAGTACCAGATTGTAGCAGTAGATGGACAACTCTCTCCAGGAGAAAAAGCAGTCCGTTTACAAGAATCAAAAGTCTTCAGAGCAGAA
                                                  Xl3.1-CHK-1012703932                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTATATTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGTTGTGATGAAGGAGCTTCAACTAAAGCCTCCACTGATCATAATTTGGCAAGGCAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACGGCAAGAGAAGGAAGAGTTCCAGAAATTACAGAAACTATTTGGATTAGACAACTCTGGAGGTTACAGGCAGCAATCCCTACAGAATATGGAAAGAGCAGTGGGAAGGGGAAGGATGCAACCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAATCTTTGGCTACTGGTGTGGATGATGGAAGAACAAAGACTTCAGGTGTTATAGAAGTTCTGACTAAATATTATCATAGTGCAGCCCATGAAGTTAGTCGAGTTTGGCTTTGCTCTCAGTTAGACCACTTCAGCAACTCTTCAGGAGATAAAGGTTGGGGCTGTGGCTTCCGAAATTTCCAGATGGTTCTTTCTTCCCTTTTGCTAAATGAAACTTACAATAACTGCTTGCAAGCTTATAGATCAATACCCTGTATTCCAAAAATACAGTGTATGATTGAAGATGCATGGAAGGAAGGTTTTGATCCCCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATCTACGGTTTGCTGACATCCCTCGATATAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTCCGTCAGGAACACATCCTCTGTTATTTAACTGGGTGCTGAATTATTATGCTTCGGAGGGGACTGGAGTTGGCAAAGTGGTCTGTACTTCCAAGATGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAACGAAAGAATAAAACCTTGTGTCTTTTAATCTTTGATCCTGGATGCTCATCTGAAAATATGCAAAAGCTATTAAAACAGAATGTAGATGGTGCTTCTCTTAAAGGGCTGCGAAAATTTGTGGGGAGTTTGAAGCACAAGCAGTACCAGATTGTAGCAGTAGATGGACAACTCTCTCCAGGAGAAAAAGCAGTCCGTTTACAAGAATCAAAAGTCTTCAGAGCAGAAAGGATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- At ---- 6e-032     NP_197856.1 expressed protein [Arabidopsis thaliana] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Os ---- 6e-033     NP_001045629.1 Os02g0106700 [Oryza sativa (japonica cultivar-group)] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 2e-062     XP_318637.4 AGAP009608-PA [Anopheles gambiae str. PEST] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-083     XP_001194853.1 PREDICTED: similar to MGC83919 protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 4e-113     NP_001076474.1 hypothetical protein LOC562478 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 4e-144     XP_419771.1 PREDICTED: similar to Chromosome 6 open reading frame 113 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 4e-145     NP_082563.1 RIKEN cDNA 2700019D07 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Hs ---- 7e-148     NP_659499.1 hypothetical protein LOC221302 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Bt ---- 9e-150     NP_001029766.1 hypothetical protein LOC533724 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 2e-151     XP_863409.1 PREDICTED: similar to CG7386-PA isoform 3 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Xt ---- 0          AAI61163.1 Hypothetical protein LOC549978 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 0          NP_001086590.1 MGC83919 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7768006.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------ATG------ATG------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2      seed Egg1                               PBX0117C10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCTGGGAACACCTAGTAAAGAAGATGGCAGACAGTATGAGTGTCCAATGTGCTCTCTTGTGTGTGCAAATACTCGTATATTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGTTGTGATGAAGGAGCTTCAACTAAAGCCTCCACTGATCATAATTTGGCAAGGCAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACGGCAAGAGAAGGAAGAGTTCCAGAAATTACAGAAACTATTTGGATTAGACAACTCTGGAGGTTACAGGCAGCAATCCCTACAGAATATGGAAAGAGCAGTGGGAAGGGGAAGGATGCAACCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAATCTTTGGCTACTGGTGTGGATGATGGAAGAACAAAGACTTCAGGTGTTATAGAAGTTCTGACTAAATATTATCATAGTGCAGCCCATGAAGTTAGTCGAGTTTGGCTTTGCTCTCAGTTAGACCACTTCAGCAACTCTTC
  5   1   2       bld Egg2                   IMAGE:5278853-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCGTGTGTGCAAATACTCGTATATTAGAAGAGCACGTAAACCTACATTTGGAAGAAAGCAGTTGTGATGAAGGAGCTTCAACTAAAGCCTCCACTGATCATAATTTGGCAAGGCAGCTTCAGGAAGAGGAAGACCATCAAAGAAGAGCTGAAGAGTCACGGCAAGAGAAGGAAGAGTTCCAGAAATTACAGAAACTATTTGGATTAGACAACTCTGGAGGTTACAGGCAGCAATCCCTACAGAATATGGAAAGAGCAGTGGGAAGGGGAAGGATGCAACCCATGGAGTTTCACTTGCACAGAGCACAGATGATGGAATCTTTGGCTACTGGTGTGGATGATGGAAGAACAAAGACTTCAGGTGTTATAGAAGTTCTGACTAAATATTATCATAGTGCAGCCCATGAAGTTAGTCGAGTTTGGCTTTGCTCTCAGTTAGACCACTTCAGCAACTCTTCAGGAGATAAAGGTTGGGGCTGTGGCTTCCGAAATTTCCAGATGGTTCTTTCTTCCCTTTTGCTAAATGAAACTTACAATAACTGCTTGCAAGCTTATAGATCAATACCCCTGTATTCCAAAAATACAGTGTATGATTGAAGATGCATGGAAGGAAGGTTTTGATCCCCAAGGTGCTTCTCATTTCATGGCAAATTACAAGGTACCAAGGCTTGGATTTGCAGCA
  5   1   2       bld Te2N                            IMAGE:7768006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTGGTGTGGATGATGGAAGAACAAAGACTTCAGGTGTTATAGAAGTTCTGACTAAATATTATCATAGTGCAGCCCATGAAGTTAGTCGAGTTTGGCTTTGCTCTCAGTTAGACCACTTCAGCAACTCTTCAGGAGATAAAGGTTGGGGCTGTGGCTTCCGAAATTTCCAGATGGTTCTTTCTTCCCTTTTGCTAAATGAAACTTACAATAACTGCTTGCAAGCTTATAGATCAATACCCTGTATTCCAAAAATACAGTGTATGATTGAAGATGCATGGAAGGAAGGTTTTGATCCCCAAGGTGCTTCTCATTTTAATGGCAAATTACAAGGTACCAAGGCTTGGATTGGAGCATGTGAAATCTACGGTTTGCTGACATCCCTCGATATAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTCCGTCAGGAACACATCCTCTGTTATTTAACTGGGTGCTGAATTATTATGCTTCGGAGGGGACTGGAGTTGGCAAAGTGGTCTGTACTTCCAAGATGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAACGAAAGAATAAAACCTTGTGTCTTTTAATCTTTGATCCTGGATGCTCATCTGANAATATGCAAAAGCTATTAAAACAGAATGTAGATGGTGCTTCTCTTAGAGGGCTGC
  3   1   2      skin Egg2                            IMAGE:5278853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGGTTTGCTGACATCCCTCGATATAAAGTGTCGAATTATTGATTTCCATCAGCCAAGCAGTCCGTCAGGAACACATCCTCTGTTATTTAACTGGGTGCTGAATTATTATGCTTCGGAGGGGACTGGAGTTGGCAAAGTGGTCTGTACTTCCAAGATGCCAATTTACTTACAACATCAAGGTCACAGCCGAACAATTGTGGGAATAGAGGAACGAAAGAATAAAACCTTGTGTCTTTTAATCTTTGATCCTGGATGCTCATCTGAAAATATGCAAAAGCTATTAAAACAGAATGTAGATGGTGCTTCTCTTAAAGGGCTGCGAAAATTTGTGGGGAGTTTGAAGCACAAGCAGTACCAGATTGTAGCAGTAGATGGACAACTCTCTCCAGGAGAAAAAGCAGTCCGTTTACAAGAATCAAAAGTCTTCAGAGCAGAAAGGATTCCATAGAGAAAATTGCATCTTTACTATTTCACTGTGCAAAATTAAAATGTATTTAATATCTGACATCTGTATNTATATTTATTAATGAGAAACATTGTTTTTAAAAGCAAATGTAACTGTTCTGTTTTTGAAAATAATATTA
  3   1   1       add Egg6                            IMAGE:4412778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCAAGGTCCCAGCCGAACAATTGTGGGAATAGAGGAACGAAAGAATAAAACCTTGTGTCTTTTAATCTTTGATCCTGGATGCTCATCTGAAAATATGCAAAAGCTATTAAAACAGAATGTAGATGGTGCTTCTCTTAAAGGGCTGCGAAAATTTGTGGGGAGTCTGAAGCACAAGCAGTACCAGATTGTAGCAGTAGATGGACAACTCTCTCCAGGAGAAAAAGCAGTCCGTCTACAAGAATCAAAAGTCTTCAGAGCAGAAANGGATTCCATAGAGAAAATTGCATTCTCTACTNATTTCACTNGTGCAAAATTAAAATGNNTATTTAATATCTGACNNATCTGTATCTATATTTATTAATGAGAAACATTGTTTTTAAAAGCAAATGTAACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)