Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jul 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL103e12.3                           13 PI      86       1192     1358                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8317790.5                       4 PI      94       1513     1855                Homeo box B3 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 84%

 1012794139 Xl3.1-IMAGE:5505822.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5505822.5 ATCGATTCGCTGGCTTGTGTGAGGGACCGGCAGTTGCANAGAGAGAGACAGAGAGACAGAGAGAGAGATGCAGTTGAGCAGATGAGACGGTGCTGGGGCAGCAGGCGATGCAGATCACTGCAGAGAGGACATGAGGAGCTGCTAAATATCTGTAAGGAGCTTCTGTCTGGAGACAAAAAGGTGCACACGGCTCGTGGATTCTCCAGAGAACTGCGGATGAGAATATTTTTTCTGCACTTTGGAGAAGAGTAAAAAACATGTCTTGGACATTAGCAGATTCGGGCAGCAGGGGAGCAGGGCCCAGGACCTCTCAAGAGGTTGCAGGATAGATATGTATTCGTCAGGAAAATCGCAGACATGGTCTCCTTGCGTCTGACGTGAAATTCAACTGTCCTTAAAAAACAGCCTGAGAACTGCGGATGAGAATATTTTTTCTGCACTTTGGAGAAGAGTAAAAAACATGTCCTTGGACATTAGCAGATTCGGGCAGCAGGGGAGCAGGGCCCAGGACCTCTCAAGACACCCCCTTGTTTTTCTTCTTGCTGTTATATCATATTTATTGGAAAAGGCAATTAAACTGGTAGCTTCCAACAACAACCCCGAAGATATCCCGTGCCAGGTGACTGTGGGGTGCCAATGTTATTCTGTAAGGGTGGGGACACCCCTCCGAGTCGGTGACAGCTGTTTTTGGGGATCTCGGAGATGCAAAAAGCCTCCTACTATGACAACCCCACTCTATTCGGAGGTTACCCGTACCAGGCAGGGAGTCTGGGATATGAAGGGCCCCAGCAATCCTTCCCCACTTCTTCCCACATGGACAATGACTTCCAGCGGTCCTCCTGCTCCCTGCAGTCTCTGGGTCCACAGGGGCCCCTGGGGGAAGCCTAAGAACCTAAATGGAGCTGCATGCGCCCCAATCTGCCATCTGAGCATAACCAGTCGCAACCCCTGTCTCCAGCAGCCAACCCCAGTAGCAACAACAATAACAACAGCAGCAACTCCCAGGCGGCCCTCAGCAAACCCTCTCCGGCCAAAAGCCAGGTCAGCTCCAGCCCAGTCAGCAAACGGATCTTCCCTTGGATGAAAGAGTCCAGACAGAACTCAAAACAGAAATCCAGCCCCCCAGCCCCAGCGGCAGAAAGCTGCGCAGGTGACAGGAGCCCCCCGGGTTCGTCTGCGTCGAAGAGAGCGCGCACCGCTTACACGAGCGCACAACTGGTGGAACTGGAGAAGGAGTTTCACTTTAATCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAACCTGCTCAACCTGAGCGAGAGGCAAATCAAGATCTGGTTCCAGAACCGAAGGATGAAGTATAAGAAAGATCAAAAGGTAAAAGGCATGTCTTCTTCATCAGGAGGACCTTCACCAACTAGCACTCCCCCCCTGAGCTTGCAATCGTCTGCAGGGTTCCTGGGATCCATGCACTCTATGACTGCTAATTATGAGGCGCCCTCCCCACCCTCCTTTAATAAACCCCACCAGAATGCCTACTATCAGAACCCTGGCAAAGGTTGCCCCTCTCAGCAGAAGTATGGGAACCCTGCTGTAGAGTACGACCACCATGGCTTACAAGGGAATGGGGGCGCCTATGTGTCACCCAATATGCAAGCAAGTCCGGTGTACGTAGGGGGTAACTATGTGGATTCTGTGCCAGCACAAGGCCCTCCTCTTTATGGTCTCAACCACCTTGCACACCAGNCCCCCAATATGGACTACAATGGGGCACCTCCC------------CAGCACATGCACCTTGTGACCCCCACCCCACTACTCAGAGCTCCACACCAGGGCAGGATCAAGAAGCCCCNAATTGACCATTGT
                                                  Xl3.1-CHK-1012706855       TCGCTGGCTTGTGTGAGGGACCGGCAGTTGCANAGAGAGAGACAGAGAGACAGAGAGAGAGATGCAGTTGAGCAGATGAGACGGTGCTGGGGCAGCAGGCGATGCAGATCACTGCAGAGAGGACATGAGGAGCTGCTAAATATCTGTAAGGAGCTTCTGTCTGGAGACAAAAAGGTGCACACGGCTCGTGGATTCTCCAGAGAACTGCGGATGAGAATATTTTTTCTGCACTTTGGAGAAGAGTAAAAAACATGTCTTGGACATTAGCAGATTCGGGCAGCAGGGGAGCAGGGCCCAGGACCTCTCAAGAGGTTGCAGGATAGATATGTATTCGTCAGGAAAATCGCAGACATGGTCTCCTTGCGTCTGACGTGAAATTCAACTGTCCTTAAAAAAxxxCCxGAGAACTGCGGATGAGAATATTTTTTCTGCACTTTGGAGAAGAGTAAAAAACATGTCCTTGGACATTAGCAGATTCGGGCAGCAGGGGAGCAGGGCCCAGGACCTCTCAAGACACCCCCTTGTTTTTCTTCTTGCTGTTATATCATATTTATTGGAAAAGGCAATTAAACTGGTAGCTTCCAACAACAACCCCGAAGATATCCCGTGCCAGGTGACTGTGGGGTGCCAATGTTATTCTGTAAGGGTGGGGACACCCCTCCGAGTCGGTGACAGCTGTTTTTGGGGATCTCGGAGATGCAAAAAGCCTCCTACTATGACAACCCCACTCTATTCGGAGGTTACCCGTACCAGGCAGGGAGTCTGGGATATGAAGGGCCCCAGCAATCCTTCCCCACTTCTTCCCACATGGACAATGACTTCCAGCGGTCCTCCTGCTCCCTGCAGTCTCTGGGTCCACAGGGGCCCCTGGGGGAAGCCTAAGAACCTAAxxGGAGCTGCATGCGCCCCAATCTGCCATCTGAGCATAACCAGTCGCAACCCCTGTCTCCAGCAGCCAACCCCAGTAGCAACAACAATAACAACAGCAGCAACTCCCAGGCGGCCCTCAGCAAACCCTCTCCGGCCAAAAGCCAGGTCAGCTCCAGCCCAGTCAGCAAACGGATCTTCCCTTGGATGAAAGAGTCCAGACAGAACTCAAAACAGAAATCCAGCCCCCCAGCCCCAGCGGCAGAAAGCTGCGCAGGTGACAGGAGCCCCCCGGGTTCGTCTGCGTCGAAGAGAGCGCGCACCGCTTACACGAGCGCACAACTGGTGGAACTGGAGAAGGAGTTTCACTTTAATCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAACCTGCTCAACCTGAGCGAGAGGCAAATCAAGATCTGGTTCCAGAACCGAAGGATGAAGTATAAGAAAGATCAAAAGGTAAAAGGCATGTCTTCTTCATCAGGAGGACCTTCACCAACTAGCACTCCCCCCCTGAGCTTGCAATCGTCTGCAGGGTTCCTGGGATCCATGCACTCTATGACTGCTAATTATGAGGCGCCCTCCCCACCCTCCTTTAATAAACCCCACCAGAATGCCTACTATCAGAACCCTGGCAAAGGTTGCCCCTCTCAGCAGAAGTATGGGAACCCTGCTGTAGAGTACGACCACCATGGCTTACAAGGGAATGGGGGCGCCTATGTGTCACCCAATATGCAAGCAAGTCCGGTGTACGTAGGGGGTAACTATGTGGATTCTGTGCCAGCACAAGGCCCTCCTCTTTATGGTCTCAACCACCTTGCACACCAGNCCCCCAATATGGACTACAATGGGGCACCTCCCATGCCA------------ATGCACCTTGTGACCCCCACCCCACTACTCAGAGCTCCACACCAGGGCAGGATCAAGAAGCCCCNAATTGAC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     702     217 
                                               BLH MIN     702     131 
                                               BLH MPR      72     131 
                                               BLH OVR     702     189 
                                               CDS MIN     702     131 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-020     NP_001021164.1 abnormal cell LINeage family member (lin-39) [Caenorhabditis elegans] ----------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 4e-023     NP_476669.3 CG31481-PA, isoform A [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 5e-023     NP_999815.2 homeobox protein Splox [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 2e-027     XP_001789503.1 PREDICTED: similar to Homeobox protein Hox-B2 (Hox-2H) (Hox-2.8) (K8) [Bos taurus] ------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Ci ---- 1e-031     NP_001027669.1 homeoprotein 3 [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Cf ==== 1e-095     XP_539485.2 PREDICTED: similar to homeobox A3 protein isoform a isoform 1 [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 6e-099     NP_001080293.1 homeo box A3 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 6e-116     NP_002137.4 homeobox B3 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 3e-117     NP_034588.2 homeo box B3 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Bt ==== 2e-118     NP_001092644.1 homeobox B3 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 7e-134     NP_571192.2 homeo box B3a [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Gg ==== 9e-135     NP_990074.1 homeo box B3 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 0          AAI35407.1 Homeo box B3 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5505822.5                                                                                  ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TAA------------------TAG------------------------------------------------------------------------------------ATG------------------TGA---------------------------------------TGA---------------------------------------------------TAG------------------------------------------------------------------------------------------------TAA------------------------------------------------------------ATG------------------------------------TGA------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------TAA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                              ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   1       add DMZ                                  xl337a18.5p ATCGATTCGCTGGCTTGTGTGAGGGACCGGCAGTTGCANagagagagacagagagacagagagagagaTGCAGTTGAGCAGATGAGACGGTGCTGGGGCAGCAGGCGATGCAGATCACTGCAGAGAGGACATGAGGAGCTGCTAAATATCTGTAAGGAGCTTCTGTCTGGAGACAAAAAGGTGCACACGGCTCGTGGATTCTCCAGAGAACTGCGGATGAGAATATTTTTTCTGCACTTTGGAGAAGAGTAAAAAACATGTCTTGGACATTAGCAGATTCGGGCAGCAGGGGAGCAGGGCCCAGGACCTCTCAAGAGGTTGCAGGATAGATATGTATTCGTCAGGAAAATCGCAGACATGGTCTCCTTGCGTCTGACGTGAAATTCAACTGTCCTTAAAAAACAGCCTATAGCagagacaagaaagagagagagagagagagagaaagagagagagggagagagagagaggctgccatagagagagTGGGATTCGAGCCACACCGTGGGCTGGATTATTACACCCCCTTGTTTTTCTTCTTGCTGTTATATCATATTTATTGGAAAAGGCAATTAAACTGGTCGCTTCCAACAACAACCCCGAAGATATCCCGTGCCAGGTGACTGTGGGGTGCCAATGTTATTCTGTAAGGGTGGGGACACCCTCCGAGTCGGTGACAGCTGTTTTTGGGGATCTCGG
  5   1   2      skin Kid  5g                         IMAGE:4030623.5p                                                                                                   CACCGCACCTTGGGTAGGATCAGTCGCTCCTCCAGGGCTCCGCGGGCTGCTCCCTGCCCTAGGTGTGCGCGCTGCAGGCTCACAGCTGCGCCAATGCGGAGGAATGGGAGAGACCAGGCAGGCTGGGAGTTGCTGCTCCGGATGCGCCGCTGCTTCTCTCTGACACCCACAGAGTCTGCTCCATCCGCGATCTCACGGCTCCTCTATAGCAGCAATTGCAGCAGCACAGCTGGGAAGCACCGCACTCTAAGATCTGTAAGGGAGCTTCTGTCTGGAGACAAAAAGGTGCACACGGCTCGTGGATTCTCCAGAGAACTGCGGATGAGAATATTTTTTCTGCACTTTGGAGAAGAGTAAAAAACATGTCCTTGGACATTAGCAGATTCGGGCAGCAGGGGAGCAGGGCCCAGGACCTCTCAAGACACCCCCTTGTTTTTCTTCTTGCTGTTATATCATATTTATTGGAAAAGGCAATTAAACTGGTAGCTTCCAACAACAACCCCGAAGATATCCCGTGCCAGGTGACTGTGGGGTGCCAATGTTATTCTGTAAGGGTGGGGACACCCCTCCGAGTCGGTGACAGCTGTTTTTGGGGATCTCGGAGATGCAAAAAGCCTCCTACTATGACAACCCCACTCTATTCGGAGGTTACCCGTACCAGGCAGGGAGTCTGGGATATGAAGGGCCCCAGCAATCCTTCCCCACTTCTTCCCACATGGACAATGACTTCCAGCGGTCCTCCTGCTCCCTGCAGTCTCTGGGTCCACAGGGGCCCCTGGGGGAAGCCTAAGAACCTAAATGGGAAGCTGGCTGCGCCCCAATCTGCCATCTGAACCTAACCAGTCGCAACCCCTGTCTCCAGCAGCCAACCCAGTAGCCACCCCCATAACACCGGCAGCAACTTCCCAGGGGGCCCTCAGA
  5   1   2       bld Tbd7                                 XL094c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGAGTCTGGGATATGAAGGGCCCCAGCAATCCTTCCCCACTTCTTCCCACATGGACAATGACTTCCAGCGGTCCTCCTGCTCCCTGCAGTCTCTGGGTCACAGTGGGCCACTGGTGAAGCCTAAGAACCTAAATGGGAGCTGCATGCGCCCCAATCTGCCATCTGAGCATAACCAGTCGCAACCCCTGTCTCCAGCAGCCAACCCCAGTAGCAACAACAATAACAACAGCAGCAACTCCCAGGCGGCCCTCAGCAAACCCTCTCCGGCCAAAAGCCAGGTCAGCTCCAGCCCAGTCAGCAAACGGATCTTCCCTTGGATGAAAGAGTCCAGACAGAACTCAAAACAGAAATCCAGCCCCCCAGCCCCAGCGGCAGAAAGCTGCGCAGGTGACAGGAGCCCCCCGGGTTCGTCTGCGTCGAAGAGAGCGCGCACCGCTTACACGAGCGCACAACTGGTGGAACTGGAGAAGGAGTTTCACTTTAATCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAACCTGCTCAACCTGAGCGAGAGGCAAATCAAGATCTGGTTCCAGAACCGAAGGATGAAGTATAAGAAAGATCAAAAGGTAAAAGGCATGTCTTCTTCATCAGGAGGACCTTCACCAACTAGCACTCCCCCCCTGAGCTTGCAATCGTCTGCAGGGTTCCTGGGATCCATGCACTCTATGACTGC
  5   1   2      seed Sp1                             IMAGE:5505822.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGATCTTCCCTTGGATGAAAGAGTCCAGACAGAACTCAAAACAGAAATCCAGCCCCCCAGCCCCAGCGGCAGAAAGCTGCGCAGGTGACAGGAGCCCCCCGGGTTCGTCTGCGTCGAAGAGAGCGCGCACCGCTTACACGAGCGCACAACTGGTGGAACTGGAGAAGGAGTTTCACTTTAATCGCTACCTGTGCCGCCCCAGGAGGGTGGAGATGGCCAACCTGCTCAACCTGAGCGAGAGGCAAATCAAGATCTGGTTCCAGAACCGAAGGATGAAGTATAAGAAAGATCAAAAGGTAAAAGGCATGTCTTCTTCATCAGGAGGACCTTCACCAACTAGCACTCCCCCCCTGAGCTTGCAATCGTCTGCAGGGTTCCTGGGATCCATGCACTCTATGACTGCTAATTATGAGGCGCCCTCCCCACCCTCCTTTAATAAACCCCACCAGAATGCCTACTATCAGAACCCTGGCAAAGGTTGCCCCTCTCAGCAGAAGTATGGGAACCCTGCTGTAGAGTACGACCACCATGGCTTACAAGGGAATGGGGGCGCCTATGTGTCACCCAATATGCAAGCAAGTCCGGTGTACGTAGGGGGTAACTATGTGGATTCTGTGCCAGCACAAGGCCCTCCTCTTTATGGTCTCAACCACCTTGCACACCAGNCCCCCAATATGGACTACAATGGGGCACCTCCCATGCCACCNANNCAGCACATGCACCTTGTGACCCCCACCCCACTACTCAGAGCTCCACACCAGGGCAGGATCAAGAAGCCCCNAATTGACCATTGTGATTNNAAACANACAANCAGTCN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)