Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4203022-IMAGp.5                 8 PI      90         18      853                Forkhead box protein J1 (FoxJ1)

 This cluster: approximate FL confidence score = 47%

 1012794208 Xl3.1-IMAGE:7978340.5 - 2 ESTs
                                                                       .........-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7978340.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGCAGGGCAATAACTCATCTCCCCACCACCTCTGCTGTTGCTGCTGCTTCCAGAACCTTCCTGCCTAGTTCTGCTGCATCCTGATCCACTGTATAGCAGGAGCACTTCTTGGATCACAAGGGCTTTATTAATGTTTGACCTGCCCAGGGCGGCCCCGTTAGACATGGCGGATAGCTGGTTGACTTTCCAGGCTGAGGAAGAGCAGGGGCAAGAGTCCTTTTCTAGCTCAGTTAACCTGGATGACAGCCTCACCAGCTTGCAGTGGCTACAAGAATTCTCCATACTCAATTCCAACGAAGGTAAAACGCCTTCATCATCTGGGGACTCCCATGGTTACAGGCAGCTGTCTGGTGCCCCCTGCTCTCCTCTGGCCGCTGACCCTGCTTGTCTGGGCATGCCACATACCCCAGGAAAACCCATTTCCTCGTCCACCTCACGGGCATCCCACTTGGGACTCCAGCCAATGGAGGAGATTGACTACAAGACCAACCCGCATGTAAAGCCCCCTTATTCATATGCCACTCTTATCTGTATGGCAATGCAAGCAAGCAAGAAGACCAAGATCACACTATCTGCCATTTACAACTGGATCACCGACAACTTCTGCTACTTCCGACATGCAGATCCCACCTGGCAGAATTCTATTAGACACAACCTCTCCCTAAATAAGTGTTTCATGAAAGTCCCTCGGGGAAAAAGACGAGCCAGGCAAAGGAGGTTTTCTGGGAGATTGATCCCACAATTGATCGGCTCATGCTCATAAATGGAAGCATGAAAGAAGCGCCGAACTTCCCCCCTGGTCCAGATCCATTCCGGCATTTTGCTTAGTGCACAAGGCTGCCAGCCTCCAGTGAATAAGCCAAAAAGAGGTTTCT
                                                  Xl3.1-CHK-1012715766                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAATAACTCATCTCCCCACCACCTCTGCTGTTGCTGCTGCTTCCAGAACCTTCCTGCCTAGTTCTGCTGCATCCTGATCCACTGTATAGCAGGAGCACTTCTTGGATCACAAGGGCTTTATTAATGTTTGACCTGCCCAGGGCGGCCCCGTTAGACATGGCGGATAGCTGGTTGACTTTCCAGGCTGAGGAAGAGCAGGGGCAAGAGTCCTTTTCTAGCTCAGTTAACCTGGATGACAGCCTCACCAGCTTGCAGTGGCTACAAGAATTCTCCATACTCAATTCCAACGAAGGTAAAACGCCTTCATCATCTGGGGACTCCCATGGTTACAGGCAGCTGTCTGGTGCCCCCTGCTCTCCTCTGGCCGCTGACCCTGCTTGTCTGGGCATGCCACATACCCCAGGAAAACCCATTTCCTCGTCCACCTCACGGGCATCCCACTTGGGACTCCAGCCAATGGAGGAGATTGACTACAAGACCAACCCGCATGTAAAGCCCCCTTATTCATATGCCACTCTTATCTGTATGGCAATGCAAGCAAGCAAGAAGACCAAGATCACACTATCTGCCATTTACAACTGGATCACCGACAACTTCTGCTACTTCCGACATGCAGATCCCACCTGGCAGAATTCTATTAGACACAACCTCTCCCTAAATAAGTGTTTCATGAAAGTCCCTCGGGGAAAAAGACGAGCCAGGCAAAGGAGGTTTTCTGGGAGATTGATCCxxxxxxTGATCGGCTCATxxxxxxAAATGGAAGCATGAAAGAAGCGCCGAACTTCCCCCCTGGTCCAGATCCATTCCGGCATTTTGCTTAGTGCACAAGGCTGCCAGCCTCCAGTGAATAAGCCAAAAAGAGGTTTCTGCCCTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     131      75                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN     131      84                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                       PROTEIN --- Dm ---- 3e-017     NP_001097726.1 CG16899 CG16899-PB [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 5e-018     NP_001041116.1 defective PHArynx development family member (pha-4) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ag ---- 1e-018     XP_314703.4 AGAP008606-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 2e-021     AAT74646.1 forkhead [Ciona intestinalis] ---------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = ?? ==== 9e-021     XP_612715.3 PREDICTED: similar to Forkhead box protein J2 (Fork head homologous X) [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Sp ---- 8e-034     NP_001073013.1 forkhead transcription factor J1 [Strongylocentrotus purpuratus] ------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 1e-061     NP_001070174.2 forkhead box transcription factor J1 [Danio rerio] -----------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Cf ==== 5e-069     XP_533124.2 PREDICTED: similar to Forkhead box protein J1 (Forkhead-related protein FKHL13) (Hepatocyte nuclear factor 3 forkhead homolog 4) (HFH-4) [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 6e-070     NP_032266.2 forkhead box J1 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 5e-071     NP_001445.2 forkhead box J1; forkhead (Drosophila)-like 13 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Bt ==== 2e-071     XP_582255.2 PREDICTED: similar to Forkhead box protein J1 (Forkhead-related protein FKHL13) (Hepatocyte nuclear factor 3 forkhead homolog 4) (HFH-4) [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Gg ==== 3e-076     XP_001233327.1 PREDICTED: similar to Forkhead box protein J1 (FoxJ1) [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 7e-101     Q5M7N6 Forkhead box protein J1 (FoxJ1) [Xenopus tropicalis]  =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 1e-110     NP_001083646.1 forkhead box protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7978340.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAA---------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Emb1 5g                         IMAGE:5161845.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGCAGGGCAATAACTCATCTCCCCACCACCTCTGCTGTTGCTGCTGCTTCCAGAACCTTCCTGCCTAGTTCTGCTGCATCCTGATCCACTGTATAGCAGGAGCACTTCTTGGATCACAAGGGCTTTATTAATGTTTGACCTGCCCAGGGCGGCCCCGTTAGACATGGCGGATAGCTGGTTGACTTTCCAGGCTGAGGAAGAGCAGGGGCAAGAGTCCTTTTCTAGCTCAGTTAACCTGGATGACAGCCTCACCAGCTTGCAGTGGCTACAAGAATTCTCCATACTCAATTCCAACGAAGGTAAAACGCCTTCATCATCTGGGGACTCCCATGGTTACAGGCAGCTGTCTGGTGCCCCCTGCTCTCCTCTGGCCGCTGACCCTGCTTGTCTGGGCATGCCACATACCCCAGGAAAACCCATTTCCTCGTCCACCTCACGGGCATCCCACTTGGGACTCCAGCCAATGGAGGAGATTGACTACAAGACCAACCCGCATGTAAAGCCCCCTTATTCATATGCCACTCTTATCTGTATGGCAATGCAAGCAAGCAAGAAGACCAAGATCACACTATCTGCCATTTACAACTGGATCACCGACAACTTCTGCTACTTCCGACATGCAGATCCCACCTGGCAGAATTCTATTAGACACAACCTCTCCCTANATAAGTGTTTCATGAAAGTCCCTCGGGGAAAAAGACGAGCCAGGCAAAGGAGGTTTTCTGGGAGATTGATCCCACAATATNGCTGATCGNGCTCATAAATGGAAGCATGAAAGAAGCGCCGAACTTCCCCCCTGGTCCAGATCCATTCCGGCATTTTGCTTAGTGCACAAGGCTGCCAGCCTCCAGTGAATAAGCCAAAAAGAGGTTTCTGCCCTGT
  5   1   2      seed Emb9 5g                         IMAGE:7978340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGGGCAATAACTCATCTCCCCACCACCTCTGCTGTTGCTGCTGCTTCCAGAACCTTCCTGCCTAGTTCTGCTGCATCCTGATCCACTGTATAGCAGGAGCACTTCTTGGATCACAAGGGCTTTATTAATGTTTGACCTGCCCAGGGCGGCCCCGTTAGACATGGCGGATAGCTGGTTGACTTTCCAGGCTGAGGAAGAGCAGGGGCAAGAGTCCTTTTCTAGCTCAGTTAACCTGGATGACAGCCTCACCAGCTTGCAGTGGCTACAAGAATTCTCCATACTCAATTCCAACGAAGGTAAAACGCCTTCATCATCTGGGGACTCCCATGGTTACAGGCAGCTGTCTGGTGCCCCCTGCTCTCCTCTGGCCGCTGACCCTGCTTGTCTGGGCATGCCACATACCCCAGGAAAACCCATTTCCTCGTCCACCTCACGGGCATCCCACTTGGGACTCCAGCCAATGGAGGAGATTGACTACAAGACCAACCCGCATGTAAAGCCCCCTTATTCATATGCCACTCTTATCTGTATGGCAATGCAAGCAAGCAAGAAGACCAAGATCACACTATCTGCCATTTACAACTGGATCACCGACAACTTCTGCTACTTCCGACATGCAGATCCCACCTGGCAGAATTCTATTAGACACAACCTCTCCCTAAATAAGTGTTTCATGAAAGTCCCTCGGGAAAAAGACGAGCCAGGCAAAGGAGTTTCTGGAAGATTGATCCACAATATGCTGATCGGCTCATAAATGGAGCCATGAAGAAGCGCCGACTTCCCCCTGTTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)