Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012794685 Xl3.1-IMAGE:4743353.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4743353.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGCACAGCACAAACAATTGTTGACAACTCTTCAGCTTCAGCTGATCTTGTAGTCAGAGGTCCCCCTGGTCCTCCAGGTGGTATCAGAGTAGAAGAACTAAGAGATACTTCTGTAAAATTAACATGGAGTAGTGGAACCGACAATCACCAGCCAATTTCTAAGTATAACATCCAGGCAAGAAATATTTTGTCTGACGACTGGAAAGATGTAAAGACAGAAAATCCAAACATTGAAGGATATATGGAGATGGCAAGAGTTATAGATCTGATTCCTTGGATGGACTATGAATTCCGGGTTATAGCAACAAACACATTAGGAGTTGGAGAACCAAGCTTGCCATCCCCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCAGAAGTTGGCGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACATGGCAGCCTTTGTCACGTGAATATCATTATGGTGATGGCTTTGGCTATGGTGTCGCCTTCAAGCCCTTCAATGTCAGGGAATGGAGAAAAGTTATTGTTTCCAACCCTGAAAGTGGTCACTATGTGCACAAGGATGACACCATAACTCCAGCAACACAGTTTCAAATAAAAGTAAAGGCCTTTAATAAAGTTGGAGAAGGTCCATACAGCAGCACTGTTGTAGTATACTCAGCAGAGGATGTGCCTACAGAAGCCCCAACGGCAGTAGTATACAATATATTGTCATCTACTGAAGTATCTGTTGCCTGGCATCCAGTTTATGAGAAATCTATTG
                                                  Xl3.1-CHK-1012717099                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCACAAACAATTGTTGACAACTCTTCAGCTTCAGCTGATCTTGTAGTCAGAGGTCCCCCTGGTCCTCCAGGTGGTATCAGAGTAGAAGAACTAAGAGATACTTCTGTAAAATTAACATGGAGTAGTGGAACCGACAATCACCAGCCAATTTCTAAGTATAACATCCAGGCAAGAAATATTTTGTCTGACGACTGGAAAGATGTAAAGACAGAAAATCCAAACATTGAAGGATATATGGAGATGGCAAGAGTTATAGATCTGATTCCTTGGATGGACTATGAATTCCGGGTTATAGCAACAAACACATTAGGAGTTGGAGAACCAAGCTTGCCATCCCCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCAGAAGTTGGCGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACATGGCAGCCTTTGTCACGTGAATATCATTATGGTGATGGCTTTGGCTATGGTGTCGCCTTCAAGCCCTTCAATGTCAGGGAATGGAGAAAAGTTATTGTTTCCAACCCTGAAAGTGGTCACTATGTGCACAAGGATGACACCATAACTCCAGCAACACAGTTTCAAATAAAAGTAAAGGCCTTTAATAAAGTTGGAGAAGGTCCATACAGCAGCACTGTTGTAGTATACTCAGCAGAGGATGTGCCTACAGAAGCCCCAACGGCAGTAGTATACAATATATTGTCATCTACTGAAGTATCTGTTGCCTGGCATCCAGTTTATGAGAAATCTATTGAAGGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       ...PROTEIN --- Ce ---- 8e-024     NP_501339.2 neuRonal IGCAM family member (rig-4) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-028     NP_001096185.1 L1 cell adhesion molecule [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-037     XP_001181157.1 PREDICTED: similar to axonin-1 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-040     NP_649461.2 CG1084-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Ag ---- 8e-041     XP_311153.2 contactin-like putative cell adhesion molecule (AGAP000007-PA) [Anopheles gambiae str. PEST] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PREDICTED - ?? ---- 8e-076     XP_001789283.1 PREDICTED: similar to Contactin-2 precursor (Axonin-1) (Axonal glycoprotein TAG-1) (Transient axonal glycoprotein 1) (TAX-1) [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 9e-086     NP_851300.2 contactin 1a [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 9e-108     NP_778203.1 contactin 1 isoform 2 precursor; glycoprotein gP135 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-108     NP_031753.1 contactin 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-109     XP_534836.2 PREDICTED: similar to contactin 1 isoform 2 precursor isoform 1 [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 7e-110     NP_776705.1 contactin 1 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 5e-113     NP_001004381.2 contactin 1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-149     NP_001081205.1 contactin A [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4743353.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---ATG---------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Eye1                   IMAGE:4743353-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGCACAGCACAAACAATTGTTGACAACTCTTCAGCTTCAGCTGATCTTGTAGTCAGAGGTCCCCCTGGTCCTCCAGGTGGTATCAGAGTAGAAGAACTAAGAGATACTTCTGTAAAATTAACATGGAGTAGTGGAACCGACAATCACCAGCCAATTTCTAAGTATAACATCCAGGCAAGAAATATTTTGTCTGACGACTGGAAAGATGTAAAGACAGAAAATCCAAACATTGAAGGATATATGGAGATGGCAAGAGTTATAGATCTGATTCCTTGGATGGACTATGAATTCCGGGTTATAGCAACAAACACATTAGGAGTTGGAGAACCAAGCTTGCCATCCCCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCAGAAGTTGGCGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACATGGCAGCCTTTGTCACGTGAATATCATTATGGTGATGGCTTTGGCTATGGTGTCGCCTTCAAGCCCTTCAATGTCAGGGAATGGAGAAAAGTTATTGTTTCCAACCCTGAAAGTGGTCACTATGTGCACAAGGATGACACCATAACTCCAGCAACACAGTTTCAAATAAAAGTAAAGGCCTTTAATAAAGTTGGAGAAGGTCCATACAGCAGCACTGTTGTAGTATACTCAGCAGAGGATGTGCCTACAGAAGCCCCAACGGCAGTAGTATACAATATATTGTCATCTACTGAAGTATCTGTTGCCTGGCATCCAGTTTATGAGAAATCTATTGAAGGTTACC
  5   1   2      seed Eye1      out                   IMAGE:4743353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACAACTCTTCAGCTTCAGCTGATCTTGTAGTCAGAGGTCCCCCTGGTCCTCCAGGTGGTATCAGAGTAGAAGAACTAAGAGATACTTCTGTAAAATTAACATGGAGTAGTGGAACCGACAATCACCAGCCAATTTCTAAGTATAACATCCAGGCAAGAAATATTTTGTCTGACGACTGGAAAGATGTAAAGACAGAAAATCCAAACATTGAAGGATATATGGAGATGGCAAGAGTTATAGATCTGATTCCTTGGATGGACTATGAATTCCGGGTTATAGCAACAAACACATTAGGAGTTGGAGAACCAAGCTTGCCATCCCCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCAGAAGTTGGCGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACATGGCAGCCTTTGTCACGTGAATATCATTATGGTGATGGCTTTGGCTATGGTGTCGCCTTCAAGCCCTTCAATGTCAGGGAATGGAGAAAAGTTATTGTTTCCAACCCTGAAAGTGGTCACTATGTGCACAAGGATGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)