Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5049055-IMAGp.5                 6 PI      90       1261     1670                (no blast hit)
     2   0.0    0Xl3.1-XL437h09ex.5                          5 PI      88       1377     1672                nucleoporin Nup153 [Xenopus laevis]
     3   0.0    0Xl3.1-XL447c20ex.3                          4 PI      90       1261     1629                nucleoporin Nup153 [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:6642679.5                       4 PI      80       1380     1672                nucleoporin Nup153 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012794792 Xl3.1-IMAGE:8319285.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8319285.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGATCAAATCAATATCAAAAAGCAGAGGAAACCTATAAAAAGGCCACAGAGCTAACAACCACTCCTGAATATGAGAAGCAGCTATCACACCTTAATTATGGAAATTTTCTAGAAAAATGGAAGAAATCTGAAAATGAAGCTGTAGAACAGTACAAGGAAGGGCTGCTGATCCCTGACCAGAGTAAATACAGACAAAAATGTGAGACGTCTCTGAGAAGGATAGCCGAGCAGAGGTTAAAGAGAAACCCCAGTGATGCTTCAGGGCTTGCTTTGCTTGGGTTCATCAGTAAGGAAAACCATGATCCACCCAATAATGAATATCTAGGAGTCCTCTTTGATCTGAAGTTAAAGTTAAGAAAATGATTTAAAACCATCCGTATTGGTGGACAAGACTTTTAAAATTTGCATTTTTGGGAGGTCTAAACTTGTTTTAATAGTAGTCTAGTTTTTAATAATATGAGTGTCAAATAATTCAGTTGTGTTATTTATAAAACTTTAGAGAACCTATGTCTATAATATGTATTAGTGCTGATTGAAAAGATAATTTGGGGATATCAACTGTGGCAACAGTGGTGTAATTATAGAGGATGCAGAGTGTATATATTGGAATCTGTTGTTGATTTGTTTATACGTATGTTTGGAAACTCTTCATTTGTGTTTATAAATATGTATCCGATATTTCCGGCTAGACAGCACAGCTTCCACAAGAAGATAAAGCTATATTATAGTAATGATATGTCATCATACATTCATACCAGGCTGTCCCAAATAGCCCATGCATGTCTGAGAAGAGAGTAGAGACATAAAAAGGAGTAGGAGGAGCAGAAAAAGACCCAGACAAAAATGCACTGTTTTTTATTTGTGCAAATAAGTGTTTATATTTTCCATCAAGGTATACACAGTTATAACTGTTCACTGGTGGGTCTGATCTACCAACTATTGAAGTTTATTATATAATTATATACTACTAGACATTAAGCCCGTTAAATTAACGGGCGCTAGAACATATGTAGTCAAACATTAAAAAAAATTCGCCTGAGATGGTCCGTGGGGCACATGCGCAGTAGCGCAATCCCACGGACACAGGGACTGGACGCAGAGACACTTCAACTTTATTATATAGGATACATACAGGTTATTTTGTTGGGGGTCCCTCTGTTAACACATTTACTTGGTTTGATTTTAACATATGTTTTTCCTATTTTGCATGTATTTTACCTTTTGGACAATAGATGGTATTAATGCTGAGTATATAAAAATCAGAATTGCTGACCACCTCTAAAAAATTGAAGTTCGCTGGGCGAATTGCTGCCTTTAGCAAGGAATCAGTATGTGGATAATCTCACGTGTCCCGGCCTCCCCTCCATTTGTACACAAACCTGCTGCTGCTGTCAGCTCTTGCTGTATGGAGCCCTGCCGGAACTCAAGTGATCTCTCCTACTCCGTATCTTGTTCCCGGTCCTCCGCCTCCTCCGGCTGCCGCCATTCGCTTATTCACAGGACCCTGTTCGTGTCACTCTTGTCCCGAGGTCCCCCCCGACTGCTCCTTCACTAACACGACTGTCTGCAAGAACTCCCGACAGGCACCGCTCAGCTGCATAGCGCTCTCCCGAAACTAAAGCGATTCCAGCAGAAGTGGGGAAAAATGCACGGTTAGCTTCCGTAACCCCCTTTCGGTCATTCTGGCCATTTTTTCAGTGCCGGGGAATTCATGTCAGCGCTGGGGCAGGAACCTGTGCCGTTCCCTGGTGCAGCAGCCACACTCAGACACTTGTTGGATTCACTGCAGGTAGCCAATGAGAATTCAGGGTACCAGTCCCTTATCTCTGTTCGGCGCCGGCTGGGCTGCAGCATATACGCAGCTCTCGCGAGACAGTTGGGAGGTATGCGCCAGAGACNGTCCGTGG
                                                  Xl3.1-CHK-1012708550                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATCAATATCAAAAAGCAGAGGAAACCTATAAAAAGGCCACAGAGCTAACAACCACTCCTGAATATGAGAAGCAGCTATCACACCTTAATTATGGAAATTTTCTAGAAAAATGGAAGAAATCTGAAAATGAAGCTGTAGAACAGTACAAGGAAGGGCTGCTGATCCCTGACCAGAGTAAATACAGACAAAAATGTGAGACGTCTCTGAGAAGGATAGCCGAGCAGAGGTTAAAGAGAAACCCCAGTGATGCTTCAGGGCTTGCTTTGCTTGGGTTCATCAGTAAGGAAAACCATGATCCACCCAATAATGAATATCTAGGAGTCCTCTTTGATCTGAAGTTAAAGTTAAGAAAATGATTTAAAACCATCCGTATTGGTGGACAAGACTTTTAAAATTTGCATTTTTGGGAGGTCTAAACTTGTTTTAATAGTAGTCTAGTTTTTAATAATATGAGTGTCAAATAATTCAGTTGTGTTATTTATAAAACTTTAGAGAACCTATGTCTATAATATGTATTAGTGCTGATTGAAAAGATAATTTGGGGATATCAACTGTGGCAACAGTGGTGTAATTATAGAGGATGCAGAGTGTATATATTGGAATCTGTTGTTGATTTGTTTATACGTATGTTTGGAAACTCTTCATTTGTGTTTATAAATATGTATCCGATATTTCCGGCTAGACAGCACAGCTTCCACAAGAAGATAAAGCTATATTATAGTAATGATATGTCATCATACATTCATACCAGGCTGTCCCAAATAGCCCATGCATGTCTGAGAAGAGAGTAGAGACATAAAAAGGAGTAGGAGGAGCAGAAAAAGACCCAGACAAAAATGCACTGTTTTTTATTTGTGCAAATAAGTGTTTATATTTTCCATCAAGGTATACACAGTTATAACTGTTCACTGGTGGGTCTGATCTACCAACTATTGAAGTTTATTATATAATTATATACTACTAGACATTAAGCCCGTTAAATTAACGGGCGCTAGAACATATGTAGTCAAACATTAAAAAAAATTCGCCTGAGATGGTCCGTGGGGCACATGCGCAGTAGCGCAATCCCACGGACACAGGGACTGGACGCAGAGACACTTCAACTTTATTATATAGGATACATACAGGTTATTTTGTTGGGGGTCCCTCTGTTAACACATTTACTTGGTTTGATTTTAACATATGTTTTTCCTATTTTGCATGTATTTTACCTTTTGGACAATAGATGGTATTAATGCTGAGTATAxxxxxxTCAGAATTGCTGACCACCTCTAAAAAATTGAAGTTCGCTGGGCGAATTGCTGCCTTTAGCAAGGAATCAGTATGTGGATAATCTCACGTGTCCCGGCCTCCCCTCCATTTGTACACAAACCTGCTGCTGCTGTCAGCTCTTGCTGTATGGAGCCCTGCCGGAACTCAAGTGATCTCTCCTACTCCGTATCTTGTTCCCGGTCCTCCGCCTCCTCCGGCTGCCGCCATTCGCTTATTCACAGGACCCTGTTCGTGTCACTCTTGTCCCGAGGTCCCCCCCGACTGCTCCTTCACTAACACGACTGTCTGCAAGAACTCCCGACAGGCACCGCTCAGCTGCATAGCGCTCTCCCGAAACTAAAGCGATTCCAGCAGAAGTGGGGAAAAATGCACGGTTAGCTTCCGTAACCCCCTTTCGGTCATTCTGGCCATTTTTTCAGTGCCGGGGAATTCATGTCAGCGCTGGGGCAGGAACCTGTGCCGTTCCCTGGTGCAGCAGCCACACTCAGACACTTGTTGGATTCACTGCAGGTAGCCAATGAGAATTCAGGGTACCAGTCCCTTATCTCTGTTCGGCGCCGGCTGGGCTGCAGCATATACGCAGCTCTCGCGAGACAGTTGGGAGGTATGCGCCAGAGACNGTCCGTGGGGCACA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       ...PREDICTED - Dr ---- 9e-007     XP_701096.2 PREDICTED: similar to interferon-inducible protein IFI58, partial [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 2e-009     NP_001103987.1 hypothetical protein LOC667373 isoform 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 7e-013     XP_001787879.1 PREDICTED: similar to Interferon-induced protein with tetratricopeptide repeats 1 (IFIT-1) [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 3e-014     XP_421662.2 PREDICTED: hypothetical protein [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 5e-014     NP_036552.1 interferon-induced protein with tetratricopeptide repeats 5 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 3e-014     XP_543917.2 PREDICTED: similar to Interferon-induced protein with tetratricopeptide repeats 5 (IFIT-5) (Retinoic acid- and interferon-inducible 58 kDa protein) [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 4e-015     NP_001069166.1 interferon-induced protein with tetratricopeptide repeats 5 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 4e-043     AAI11544.1 Unknown (protein for IMAGE:4409068) [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8319285.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGA---------------------------------TAA---------------------TAA---------------------------------ATG---------TAA------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------TAG---------------TAG---------------------------ATG------------------------------------------------------------------------------------------------------------TAA------------------TAA------TAA------------TAG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TGA---------------------TGA---------------TGA------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   1       add Bone                            IMAGE:8743075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGATCAAATCAATATCAAAAAGCAGAGGAAACCTATAAAAAGGCCACAGAGCTAACAACCACTCCTGAATATGAGAAGCAGCTATCACACCTTAATTATGGAAATTTTCTAGAAAAATGGAAGAAATCTGAAAATGAAGCTGTAGAACAGTACAAGGAAGGGCTGCTGATCCCTGACCAGAGTAAATACAGACAAAAATGTGAGACGTCTCTGAGAAGGATAGCCGAGCAGAGGTTAAAGAGAAACCCCAGTGATGCTTCAGGGCTTGCTTTGCTTGGGTTCATCAGTAAGGAAAACCATGATCCACCCAATAATGAATATCTAGGAGTCCTCTTTGATCTGAAGTTAAAGTTAAGAAAATGATTTAAAACCATCCGTATTGGTGGACAAGACTTTTAAAATTTGCATTTTTGGGAGGTCTAAACTTGTTTTAATAGTAGTCTAGTTTTTAATAATATGAGTGTCAAATAATTCAGTTGTGTTATTTATAAAACTTTAGAGAACCTATGTCTATAATATGTATTAGTGCTGATTGAAAAGATAATTTGGGGATATCAACTGTGGCAACAGTGGTGTAATTATAGAGGATGCAGAGTGTATATATTGGAATCTGTTGTTGATTTGTTTATACGTATGTTTGGAAACTCTTCATTTGTGTTTATAAATATGTATCCGATATTTCCGGCTAGACAGCACAGCTTCCACAAGAAGATAAAGCTATATTATAGTAATGATATGTCATCATACAT
  5   1   1       add Bone                            IMAGE:8743477.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGCTTCCACAAAGAGATAAAGGCTATATTATAGTAATGATATGTCATCATACATTCATACCAGGCTGTCCCAAATAGCCCATGCATGTCTGAGAAGAGAGTAGAGACATAAAAAGGAGTAGGAGGAGCAGAAAAAGACCCAGACAAAAATGCACTGTTTTTTATTTGTGCAAATAAGTGTTTATATTTTCCATCAAGGTATACACAGTTATAACTGTTCACTGGTGGGTCTGATCTACCAACTATTGAAGTTTATTATATAATTATATACTACTAGACATTAAGCCCGTTAAATTAACGGGCGCTAGAACATATGTAGTCAAACATTaaaaaaaaTTCGCCTGAGATGGTCCGTGGGGCACATGCGCAGTAGCGCAATCCCACGGACACAGGGACTGGACGCAGAGACACTTCAACTTTATTATATAGGATACATACAGGTTATTTTGTTGGGGGTCCCTCTGTTAACACATTTACTTGGTTTGATTTTAACATATGTTTTTCCTATTTTGCATGTATTTTACCTTTTGGACAATAGATGGTATTAATGCTGAGTATATAAAAAGAACATCTTGCTGCCATCTCATTTAGCCTATGATTAAAGGGTGTTCCCAAAACATTAGCATCTATAACACACCAGCCATCTGGCTTTTTTATGACTTAAGGGCATGTAAAGCAAAAATATATCCATTTTACTTTCTTATGAAAAGAACTATCTCGATATATTTTAATAAAATGTGTACGGTTTTATAGAACTGACTGTACGTATGATTCCACTTCATACTGCTGAATGAATGCGATGGTCTACTGCTGACCAGGAAATATCTATCTAGAAACGCAAG
  5  -1   2      seed Neu7                                 XL050b05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACAAAGCTGTGGTTGTCAATACAGTGAGTGCTGATCCTTCTGACtctctctatctatctatatatctatctatataCACACACATAAAGCACTGCGTATCTTGACAGCGCTATATAAATGACTAGACATTAAGCCCGTTAAATTAACGGGCGCTAGAACATATGTAGAAAAATCGCCAGAGACGGTCCGTGGGGCACATGCGCAGTAGCGCAATCCCACGGACACAGGGACTGGTATTTTATATTGACTGAAAATGCTCCATGTTTAATGTGTTGTCTATTGCTCCATTTACATTTGAAAATCCCTATAACAGACAGCAAGGTCAGTGATCACACCGCTGCTTGTGACAAATGGGCCGACTCCCTATTCTCCCACTCAACACACGTCCGACACCCCCGGCTCAGAATTGCTGACCACCTCTAAAAAATTGAAGTTCGCTGGGCGAATTGCTGCCTTTAGCAAGGAATCAGTATGTGGATAATCTCACGTGTCCCGGCCTCCCCTCCATTTGTACACAAACCTGCTGCTGCTGTCAGCTCTTGCTGTATGGAGCCCTGCCGGAACTCAAGTGATCTCTCCTACTCGGTATCTTGTTCCCGGTCCTCCGCCTCCTCCGGCTGCCGCCATTCGCTTCCTCGTGCCGAATTCCTCAGCCC
  5   1   2       bld Em10                            IMAGE:8319285.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCGGCTCAGAATTGCTGACCACCTCTAAAAAATTGAAGTTCGCTGGGCGAATTGCTGCCTTTAGCAAGGAATCAGTATGTGGATAATCTCACGTGTCCCGGCCTCCCCTCCATTTGTACACAAACCTGCTGCTGCTGTCAGCTCTTGCTGTATGGAGCCCTGCCGGAACTCAAGTGATCTCTCCTACTCCGTATCTTGTTCCCGGTCCTCCGCCTCCTCCGGCTGCCGCCATTCGCTTATTCACAGGACCCTGTTCGTGTCACTCTTGTCCCGAGGTCCCCCCCGACTGCTCCTTCACTAACACGACTGTCTGCAAGAACTCCCGACAGGCACCGCTCAGCTGCATAGCGCTCTCCCGAAACTAAAGCGATTCCAGCAGAAGTGGGGAAAAATGCACGGTTAGCTTCCGTAACCCCCTTTCGGTCATTCTGGCCATTTTTTCAGTGCCGGGGAATTCATGTCAGCGCTGGGGCAGGAACCTGTGCCGTTCCCTGGTGCAGCAGCCACACTCAGACACTTGTTGGATTCACTGCAGGTAGCCAATGAGAATTCAGGGTACCAGTCCCTTATCTCTGTTCGGCGCCGGCTGGGCTGCAGCATATACGCAGCTCTCGCGAGACAGTTGGGAGGTATGCGCCAGAGACNGTCCGTGGGGCACATGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)