Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xlk113b03ex.5                         3 PI      90          1      379                paraxis-like protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 93%

 1012794859 Xl3.1-xlk65m08ex.3 - 4 ESTs
                                                                       ........-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk65m08ex.3                                                                                                                                           TGGGGACACCAGGAGAAATAAATGCCCCGTTGGAGCTGAGAGGAATAGGAGTTGAGTTGGCCCAGGGCTCACATGGCCTTCACCATGATCCGTTCCATGTCAACGCATGTGATTTATCCGGACATGTCCATGTTGTCAGAGGATGAGGAGAATCAGGGAGAGAGCGATGATTCTGACCAATCGTTTGGCTGCTACCAGAGCTCATCCAAGAGGAGGAAAGTGCCCGGCAAGAATGGGCAGCAGGTGGTTGTGGTGAAACAGAGGCAGGCGGCCAATGCCAGAGAGAGAGATCGCACCCAAAGCGTAAACACCGCTTTCACCGCCCTACGCACCCTCATCCCCACCGAGCCAGTGGATAGGAAACTCTCCAAGATAGAGACCTTGCGCCTGGCCTCCAGTTACATCGCGCACTTGGCCAACGTGCTGCTGCTGGGCGAGGGGTGCCAGGATGGACAGCCGTGCTTCAGTACCGTCTACAGAGCCAAGGACAGCGGCGCAGAGGGCAAACTGCCCCGCAGCATCTGTACTTTCTGCCTTAGCAACCAAAGAAAGGGGGTCACACGCAGAGAGCATGCTGGGAACTGTCTGAAAATTCGGGGGCTTAACACATTGCGATGACCCCTGAGTATCAAGGAGGATGGATTGTAGGATCCCCATATCTTTCTTTCCCGTACTGAGAGGACTAAGTGCCAGTGCAGCTGCTTACCAAGGTCTGGTGGGCACGGCTGGGATAGAACTTGACATCTGTCAGGCACAGATTAGCCACTGGCTCAGGATGGACCCTCCATGGTGATATCTTCCTTCTGAGAGCTGGACTTCCTCCAGGAGAGCACAGGGACTCTGGGTCACTGACCCCACAGCACTGACTAATTCATGTAAATATTTGTAAAATAGGCAAAGGGTTATTAAAGTGTCACTCGTGCAACGAGAAACTCA
                                                  Xl3.1-CHK-1012707912                                                                                                                                                 CACCAGGAGAAATAAATGCCCCGTTGGAGCTGAGAGGAATAGGAGTTGAGTTGGCCCAGGGCTCACATGGCCTTCACCATGATCCGTTCCATGTCAACGCATGTGATTTATCCGGACATGTCCATGTTGTCAGAGGATGAGGAGAATCAGGGAGAGAGCGATGATTCTGACCAATCGTTTGGCTGCTACCAGAGCTCATCCAAGAGGAGGAAAGTGCCCGGCAAGAATGGGCAGCAGGTGGTTGTGGTGAAACAGAGGCAGGCGGCCAATGCCAGAGAGAGAGATCGCACCCAAAGCGTAAACACCGCTTTCACCGCCCTACGCACCCTCATCCCCACCGAGCCAGTGGATAGGAAACTCTCCAAGATAGAGACCTTGCGCCTGGCCTCCAGTTACATCGCGCACTTGGCCAACGTGCTGCTGCTGGGCGAGGGGTGCCAGGATGGACAGCCGTGCTTCAGTACCGTCTACAGAGCCAAGGACAGCGGCGCAGAGGGCAAACTGCCCCGCAGCATCTGTACTTTCTGCCTTAGCAACCAAAGAAAGGGGGTCACACGCAGAGAGCATGCTGGGAACTGTCTGAAAATTCGGGGGCTTAACACATTGCGATGACCCCTGAGTATCAAGGAGGATGGATTGTAGGATCCCCATATCTTTCTTTCCCGTACTGAGAGGACTAAGTGCCAGTGCAGCTGCTTACCAAGGTCTGGTGGGCACGGCTGGGATAGAACTTGACATCTGTCAGGCACAGATTAGCCACTGGCTCAGGATGGACCCTCCATGGTGATATCTTCCTTCTGAGAGCTGGACTTCCTCCAGGAGAGCACAGGGACTCTGGGTCACTGACCCCACAGCACTGACTAATTCATGTAAATATTTGTAAAATAGGCAAAGGGTTATTAAAGTGTCACTCGTGCAACGAGA
                                                      consensus depths                                                                                                                                                1     1     2     3     2     3     2     3     1     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1
                                               BLH ATG      72     493                                                                                                                                           
                                               BLH MIN      72      73                                                                                                                                           
                                               BLH OVR      72     289                                                                                                                                           
                                               ORF LNG      72       5                                                                                                                                           
                                                                                                                                                                                                              PROTEIN --- Ce ---- 8e-011     NP_505401.1 heart- neural crest derivatives-expressed protein 1 like (5J758) [Caenorhabditis elegans] --------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                      PROTEIN --- Sp ---- 2e-013     NP_001099179.1 twist [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             
                                                                       PROTEIN --- Ag ---- 2e-014     XP_313672.4 AGAP004386-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                                                                                                              PROTEIN --- Ci ---- 7e-016     NP_001071797.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 5e-020     NP_001014730.1 CG33557-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 3e-059     NP_571047.1 paraxis [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PREDICTED = Cf ==== 1e-063     XP_852061.1 PREDICTED: similar to Transcription factor 15 (bHLH-EC2 protein) (Paraxis) [Canis familiaris] ============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 4e-064     NP_004600.2 basic helix-loop-helix transcription factor 15 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Bt ==== 5e-065     NP_001075190.1 basic helix-loop-helix transcription factor 15 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 5e-065     NP_033354.2 transcription factor 15 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 6e-072     NP_990277.1 paraxis [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 1e-082     CAJ83180.1 transcription factor 15 (basic helix-loop-helix) [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 7e-100     NP_001087941.1 paraxis-like protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-xlk65m08ex.3                                                                                                                                                             TAAATG------------TGA------TAG------------------------ATG---------ATG---------ATG------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------TAG------------------------------------------------------------------------------------------TGA------------------TAG------------------------ATG---------------TGA------------------------------------------TGA---------------TAA---ATGTAA------------TAG------------TAA
                                                                   ORF                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  3   1   1       add Ga18 5g3  in                       xlk65m08ex.3p                                                                                                                                           TGGGGACACCAGGAGAAATAAATGCCCCGTTGGAGCTGAGAGGNATAGGAGTTGAGTTNNNCCAGGGCTCACATGGCCTTCACCATGATNCGTTCCATGTCAACGCATGTGATTTATCCGGACATGTNCATGTTGTCAGAGGATGAGGAGAATCAGGGAGAGAGCGATGATTCTGNCCAATCGTTTGGCTGCTACCAGAGCTCATCCAAGAGGAGGAAAGTGCCCGGCAAGAATGGGCAGCAGGTGGTTGTGGTGAAACAGAGGCAGGCGGCCAATGCCAGAGAGAGAGATCGCACCCAAAGCGTAAACACCGCTTTCACCNCCCTACGCACCCTCATCCCCACCGAGCCAGTGGATAGGAAACTCTCCAAGATAGAGACCTTGCNCCTGGCCTCCAGTTACATCGCGCACTTGGCCAACGTGCTGCTGCTGGGCGAGGGGTGCCAGGATGGACAGCCGTGCTTCAGTACCGTCTACAGAGCCAAGGACANCGGCGCAGAGGNCAAACNNCCCCGCAGCATCTGTACTTTCTGCCTTAGCAACCAAAGAAAGGGGGTCACACGCAGAGAGCATGCTGGGAACTGTCTGAAAATTCGGGGGCTTAACACATTGCGATGACCCCTGAGTATCAAGGAGGATGGATTGTAGGATCCCCATATCTTTCTTTCCCGTACTGAGAGGACTAAGTGCCAGTGCAGCTGCTTACCAAGGTCTGGTGGGCACGGCTGGGATAGAACTTGACATCTGTCAGGCACAGATNNNNNNTGGCTCAGGATGGACCCTCCATGGTGATATCTTCCTTCTGAGAGCTGGACTTCCTCCAGGAGAGCACAGGGACTCTGNTCACTGACCCCACAGCACTGACTAATTCATGTAAATATTTGTAAAATAGGCAAAGGGTTAATTAAA
  5   1   2      seed Neu7 5g3  in                         XL013c24.5p                                                                                                                                            GGGACACCAGGNAGAAATAAATGCCCCGTTGGAGCTGAGAGGAATAGGAGTTGAGTTGGCCCAGGGCTCACATGGCCTTCACCATGATCCGTTCCATGTCAACGCATGTGATTTATCCGGACATGTCCATGTTGTCAGAGGATGAGGAGAATCAGGGAGAGAGCGATGATTCTGACCAATCGTTTGGCTGCTACCAGAGCACATCCAAGAGGAGGAAAGTGCCCGGCAAGAATGGGCAGCAGGTGGTTGTGGTGAAACAGAGGCAGGCGGCCAATGCCAGAGAGAGAGATCGCACCCAAAGCGTAAACACCGCTTTCACCGCCCTACGCACCCTCATCCCCACCGAGCCAGTGGATAGGAAACTCTCCAAGATAGAGACCTTGCGCCTGGCCTCCAGTTACATCGCGCACTTGGCCAACGTGCTGCTGCTGGGCGAGGGGTGCCAGGATGGACAGCCGTGCTTCAGTACCGTCTACAGAGCCAAGGACAGCGGCGCAGAGGGCAAACTGCCCCGCAGCATCTGTACTTTC
  5   1   1       add Ga18 5g3  in                       xlk65m08ex.5p                                                                                                                                              TGGNNACCAGGAGAAATAAATGCCCCGTTGGAGCTGAGAGGAATAGGAGTTGAGTTGGCCCAGNNTCACATGGCCTTCACCATGATCCGTTCCATGTCAACGCATGTGATTTATCCGGACATGTCCATGTTGTCAGAGGATGAGGAGAATCAGGGAGAGAGCGATGATTCTGACCAATCGTTTGGCTGCTACCAGAGCTCATCCAAGAGGAGGAAAGTGCCCGGCAAGAATGGGCAGCAGGTGGTTGTGGTGAAANAGAGGCAGGCGGCCAATGCCAGAGAGAGAGATCGCACCCAAAGCGTAAACACCGCTTTCACCGCCCTACGCACCCTCATCCCCACCGAGCCAGTGGATAGGAAACTCTCCAAGATAGAGACCTTGCGCCTGGNCTCCAGTTACATCGCGCACTTGGCCAACGTGCTGCTGCTGGGCGAGGGGTGCCAGGATGGACAGCCGTGCTTCAGTACCGTCTACAGAGCCAAGGACAGCGGCNNAGAGGGCAAACTGCCCCGCNNCATCTGTACTTTCTGCCTTAGCAACCAAAGAAAGGGGGTCACACGCAGAGAGCATGCTGGGAACTGTCTNNNNTTCGGGGGCTTAACACATTGCGATGACCCCTGAGTATCAAGGAGGATGGATTGTAGGATCCCCATATCTTTCTTTCCCGTACTGAGAGGACTAAGTNCCAGTNCAGCTGNTTACCAAGGNCTGGTGGNNNCNNNTGGGNNAGAACTTGACATCTGTCAGGCACA
  3   1   2       bld Neu7 5g3  in                         XL013c24.3p                                                                                                                                                                                                                                                                                                                                                              AAAGTGCCCGGCAAGAATGGGCAGCAGGTGGTTGTGGTGAAACAGAGGCAGGCGGCCAATGCCAGAGAGAGAGATCGCACCCAAAAGCGTAAACACCGGCTTTCACCGCCCTACGCACCCCTCATCCCCACCGAAGCCAGTGGATAGGAAACTCTCCCAAGATAGAGACCTTGCGCCTGGCCTCCAGTTACATCGCGCACTTGGCCAACGTGCTGCTGCTGGGCGAGGGGTGCCAGGATGGACAGCCGTGCTTCAGTACCGTCTACAGAGCCAAGGACAGCGGCGCAGAGGGCAAACTGCCCCGCAGCATCTGTACTTTCTGCCTTAGCAACCAAAGAAAGGGGGTCACACGCAGAGAGCATGCTGGGAACTGTCTGAAAATTCGGGGGCTTAACACATTGCGATGACCCCTGAGTATCAAGGAGGATGGATTGTAGGATCCCCATATCTTTCTTTCCCGTACTGAGAGGACTAAGTGCCAGTGCAGCTGCTTACCAAGGTCTGGTGGGCACGGCTGGGATAGAACTTGACATCTGTCAGGCACAGATTAGCCACTGGCTCAGGATGGACCCTCCATGGTGATATCTTCCTTCTGAGAGCTGGACTTCCTCCAGGAGAGCACAGGGACTCTGGGTCACTGACCCCACAGCACTGACTAATTCATGTAAATATTTGTAAAATAGGCAAAGGGTTATTAAAGTGTCACTCGTGCAACGAGAAACTCACTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)