Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl226j13.5                            2 END     2         100      100                matrix metalloproteinase 21 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012794897 Xl3.1-xl327p20.3 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl327p20.3 CGAGAAAAAAGTATTTATTAGTTGAGATGAATCCCAATTTGGGAAGATTGAGAGTTGAACAAGGATCCTTATTATGTATCTGCTTAAATGTTTTATTTATCCATTTTTGCTTGAGTTTCTGCTTCGATTAGAAAGTATTGGAGCATGATTCATAATGATTGAACTGATGTGAACTTCTCCAGAATGCACTTCTAAACACAAACATAATACTGATGGAGGAGGAATAATTGTATGGGGATAGAGGCTCCATAGAAGGCAAACTTTAAGGCTGCAATAATATTGTGGTCAAATATGTGCTTTCTCCTTGGTGGTAAAGGTTTATTGAAGGCCCTTTGCTTCTTCTGCTCAACAGTGGACCATGTGCTCAAAGTAAGCTCCCTACACAATGGTTGATGGAAATGTGACTGGTCTGCATGAAGCCCTCAACCCAACTGAACAACTGTGGGATGAATTGGACCATGGACTAAGGGAGCCAGGCCGGATCATTGAAGCCGGACCTCACTCATGCTTTTGTGGTTGAAGAGCAAATCCCACCACTAATCTTCCAAGACCTAGAGGAAAGCCTTTCCAGAAGAGCAGAGGCTGTTGCAGCAAAGGAATGTCTAACTCTATATCAAAACCTTCAGGCTTCAGAATTGCATGTTCTCATTAATAAATGTGTAGCATCGGGACTCTATAGCTCTTAAAGGCCGTGCATGTTTGATTTAGAAAGATACACTTGATGTTATTACT
                                                  Xl3.1-CHK-1012717219       AAAAGTATTTATTAGTTGAGATGAATCCCAATTTGGGAAGATTGAGAGTTGAACAAGGATCCTTATTATGTATCTGCTTAAATGTTTTATTTATCCATTTTTGCTTGAGTTTCTGCTTCGATTAGAAAGTATTGGAGCATGATTCATAATGATTGAACTGATGTGAACTTCTCCAGAATGCACTTCTAAACACAAACATAATACTGATGGAGGAGGAATAATTGTATGGGGATAGAGGCTCCATAGAAGGCAAACTTTAAGGCTGCAATAATATTGTGGTCAAATATGTGCTTTCTCCTTGGTGGTAAAGGTTTATTGAAGGCCCTTTGCTTCTTCTGCTCAACAGTGGACCATGTGCTCAAAGTAAGCTCCCTACACAATGGTTGATGGAAATGTGACTGGTCTGCATGAAGCCCTCAACCCAACTGAACAACTGTGGGATGAATTGGACCATGGACTAAGGGAGCCAGGCCGGATCATTGAAGCCGGACCTCACTCATGCTTTTGTGGTTGAAGAGCAAATCCCACCACTAATCTTCCAAGACCTAGAGGAAAGCCTTTCCAGAAGAGCAGAGGCTGTTGCAGCAAAGGAATGTCTAACTCTATATCAAAACCTTCAGGCTTCAGAATTGCATGTTCTCATTAATAAATGTGTAGCATCGGGACTCTATAGCTCTTAAAGGCCGTGCATGTTTGATTTAGAAAGATACACTTGATGTTATTACTGAGCTT
                                                      consensus depths      1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2
                                                      Xl3.1-xl327p20.3                   TAG------TGA------------------TGA---------------------------------TAAATG---------------------TGA------------------------------ATG------------TGA---------------------ATG------TAA---------TAA---TGA------------------ATG---------------TAG---------------------------------------ATG------------------------------------------------------------------------------------------------TGA---------------------TGA---------------TGA------------TGA------------------------------------TGA---------------ATG------------------------------TAA------------TAG------------------------------------------------TAA---------------------------------ATG------------------TAG------------------------------------------TAG
  3   1   2       bld DMZ  5g3  out                        xl226j13.3p CGAGAAAAAAGTATTTATTAGTTGAGATGAATCCCAATTTGGGAAGATTGAGAGTTGAACAAGGATCCTTATTATGTATCTGCTTAAATGTTTTATTTATCCATTTTTGCTTGAGTTTCTGCTTCGATTAGAAAGTATTGGAGCATGATTCATAATGATTGAACTGATGTGAACTTCTCCAGAATGCACTTCTAAACACAAACATAATACTGATGGAGGAGGAATAATTGTATGGGGATAGAGGCTCCATAGAAGGCAAACTTTAAGGCTGCAATAATATTGTGGTCAAATATGTGCTTTCTCCTTGGTGGTAAAGGTTTATTGAAGGCCCTTTGCTTCTTCTGCTCAACAGTGGACCATGTGCTCAAAGTAAGCTCCCTACACAATGGTTGATGGAAATGTGACTGGTCTGCATGAAGCCCTCAACCCAACTGAACAACTGTGGGATGAATTGGACCATGGACTAAGGGAGCCAGGCCGGATCATTGAAGCCGGACCTCACTCATGCTTTTGTGGTTGAAGAGCAAATCCCACCACTAATCTTCCAAGACCTAGAGGAAAGCCTTTCCAGAAGAGCAGAGGCTGTTGCAGCAAAGGAATGTCTAACTCTATATCAAAACCTTCAGGCTTCAGAATTGCATGTTCTCATTAATAAATGTGTAGCATCGGGACTCTATAGCTCTTAAAGGCCGTGCATGTTTGATTTAGAAAGATACACTTGATGTTATTACTGAGCTTAT
  3   1   2      seed DMZ  5g3  out                        xl327p20.3p                         AGATGAATCCCAATTTGGGAAGATTGAGAGTTGAACAAGGATCCTTATTATGTATCTGCTTAAATGTTTTATTTATCCATTTTTGCTTGAGTTTCTGCTTCGATTAGAAAGTATTGGAGCATGATTCATAATGATTGAACTGATGTGAACTTCTCCAGAATGCACTTCTAAACACAAACATAATACTGATGGAGGAGGAATAATTGTATGGGGATAGAGGCTCCATAGAAGGCAAACTTTAAGGCTGCAATAATATTGTGGTCAAATATGTGCTTTCTCCTTGGTGGTAAAGGTTTATTGAAGGCCCTTTGCTTCTTCTGCTCAACAGTGGACCATGTGCTCAAAGTAAGCTCCCTACACAATGGTTGATGGAAATGTGACTGGTCTGCATGAAGCCCTCAACCCAACTGAACAACTGTGGGATGAATTGGACCATGGACTAAGGGAGCCAGGCCGGATCATTGAAGCCGGACCTCACTCATGCTTTTGTGGTTGAAGAGCAAATCCCACCACTAATCTTCCAAGACCTAGAGGAAAGCCTTTCCAGAAGAGCAGAGGCTGTTGCAGCAAAGGAATGTCTAACTCTATATCAAAACCTTCAGGCTTCAGAATTGCATGTTCTCATTAATAAATGTGTAGCATCGGGACTCTATAGCTCTTAAAGGCCGTGCATGTTTGATTTAGAAAGATACCACCTTGATGTTATTACTGAGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)