Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-XL415k14ex.5                          3 END     2         100       66                TGF-beta family member lefty-B [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk141c05ex.3.5                      15 PI      84         73      622                TGF-beta family member lefty-A [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012794936 Xl3.1-xlk71b13ex.3 - 2 ESTs
                                                                       ....-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk71b13ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGCTNGTCC------------NTCAATGAGCAG------------GACTGCTCAGCA------------AAAGACAACNTCTGCTGCAGAGAGGAATNTTTCATT------------CTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATACAACGCTTTTCGGTGCACT------------CANCCAAAGTACCCCTTGTCTCATTATCACTATGGACAGAGNACATGCGCCGTGGTGGAAAGCGCCCCACTACCCGTAATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCGGAGTTCCCTAATATGATTGTCGAAAAATGCGGTTGCACAATGGACAATATCGCTATCATATGACAGATGGCAGCACTAAGTTCATGCAGATCCGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCATGTGTTCAGTGCTGGCAGGGGCCCATTTCGTAAAGTAGGACTGAGCGCCTTTTGGCCTCTACAGCTTTTAAAAGGATGCTGTGAGTTGTACTTTAACAGCAGGGTTGCAGTTTGGGCAAACTGATGTAATGTGCACCCTGCTGTCACCATCTTGCCCTACTGACAGGTGTTAGTTACTACTGCCTCAAAGGGATGTGGAGGGCCCAGTGCAGCTGCCCCTGCACTTACCCTGAAGACAGCCCTGTTAGCAACGGAACCGTAAGAATATGGTTTTACCTAGACCAAATCTTACTACTCCTTCTGGGAGTTTGTAAAAGCAGCGACAATTTCCGATCTCAGTAATGTCTGTGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTAATATAGATATTTATCTCTCGTTGACTCAGCCACACTGCGGCATGGAGATGGCTCATAAAATATAAATTTGACAGAGGTATTTCTATTGGAAGATCATTTC
                                                  Xl3.1-CHK-1012716431                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------------------------GAGCAGGGGACC------------TCAGCATCAGGT------------AACNTCTGCTGCAGAGAGGAATNTTTCATTANCTTTNGGGAACTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATACAACGCTTTTCGGTGCACTGGAANT------------AAGTACCCCTTGTCTCATTATCACTATGGACAGAGNACATGCGCCGTGGTGGAAAGCGCCCCACTACCCGTAATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCGGAGTTCCCTAATATGATTGTCGAAAAATGCGGTTGCACAATGGACAATATCGCTATCATATGACAGATGGCAGCACTAAGTTCATGCAGATCCGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCATGTGTTCAGTGCTGGCAGGGGCCCATTTCGTAAAGTAGGACTGAGCGCCTTTTGGCCTCTACAGCTTTTAAAAGGATGCTGTGAGTTGTACTTTAACAGCAGGGTTGCAGTTTGGGCAAACTGATGTAATGTGCACCCTGCTGTCACCATCTTGCCCTACTGACAGGTGTTAGTTACTACTGCCTCAAAGGGATGTGGAGGGCCCAGTGCAGCTGCCCCTGCACTTACCCTGAAGACAGCCCTGTTAGCAACGGAACCGTAAGAATATGGTTTTACCTAGACCAAATCTTACTACTCCTTCTGGGAGTTTGTAAAAGCAGCGACAATTTCCGATCTCAGTAATGTCTGTGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTAATATAGATATTTATCTCTCGTTGACTCAGCCACACTGCGGCATGGAGATGGCTCATAAAATATAAATTTGACAGAGGTATTTCTATTGGAAGAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        1     1     0     1     1     1     0     1     1     1     0     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     0     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN      27      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                     PROTEIN --- Mm ---- 8e-011     NP_034224.1 endometrial bleeding associated factor [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PREDICTED - Bt ---- 1e-011     XP_613627.3 PREDICTED: similar to signaling molecule LEFTY-A [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN --- Sp ---- 2e-012     NP_001123281.1 lefty [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 1e-012     XP_547508.2 PREDICTED: similar to left-right determination, factor B preproprotein [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Hs ---- 7e-013     NP_003231.2 endometrial bleeding associated factor preproprotein; transforming growthfactor, beta-4 (endometrial bleeding-associated factor; LEFTY A) [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN --- Ci ---- 5e-025     NP_001071997.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN --- Gg ---- 3e-026     NP_990095.1 lefty [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN --- Dr ---- 2e-036     NP_571036.1 lefty2 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Xt ---- 5e-050     AAI67366.1 Unknown (protein for MGC:135826) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Xl ---- 8e-053     NP_001082043.1 TGF-beta family member lefty-B [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-xlk71b13ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG------------------------------------------------------ATG------------------------ATG------------------TGA---ATG------------------------------------------------------------------------------------------------TAA------------------------------------------ATG---TGA---------TAA---------------------------ATGTAA---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------TAG---------------TAA------TAA------------------------------------------------------TAA
  3   1   2      seed Ga18 5g3  out                      xlk71b13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANNCATGCNTCNNAGNNGNAAANNNTGNTTNNNTTNCNCNNCCCAGNNNNATCANNCNACTNTCTGGGAANNCAGAGCTNGTCCTGTTNCTCTCNNNTCAATGAGCAGGGGACCNGTNGAGACTGCTCAGCATCAGGTNNCAAGAAAGACAACNTCTGCTGCAGAGAGGAATNTTTCATTANCTTTNGGGAACTTACCTGGACACAGTACTGGATTATTGAGCCAGCAGGATACAACGCTTTTCGGTGCACTGGAANTTGNANGCANCCAAAGTACCCCTTGTCTCATTATCACTATGGACAGAGNACATGCGCCGTGGTGGAAAGCGCCCCACTACCCGTAATGTACCTGGTCAAAAAGGGAGACTACACGGAAATCGAAGTGGCGGAGTTCCCTAATATGATTGTCGAAAAATGCGGTTGCACAATGGACAATATCGCTATCATATGACAGATGGCAGCACTAAGTTCATGCAGATCCGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCATGTGTTCAGTGCTGGCAGGGGCCCATTTCGTAAAGTAGGACTGAGCGCCTTTTGGCCTCTACAGCTTTTAAAAGGATGCTGTGAGTTGTACTTTAACAGCAGGGTTGCAGTTTGGGCAAACTGATGTAATGTGCACCCTGCTGTCACCATCTTGCCCTACTGACAGGTGTTAGTTACTACTGCCTCAAAGGGATGTGGAGGGCCCAGTNCAGCTNNCCCTGCACTTACCCTGAAGACAGCCCTGTTAGCAACGGAACCGTAAGAATATGGTTTTACCTAGACCAAATCTTACTACTCCTTCTGGGAGTTTGTAAAAGCAGCGACAATTTCCGATCTCAGTAATGTCTGTGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTAATATAGATATTTATCTCTCGTTGACTCANNCACACTGCGGCATGGAGATGGCTCATAAAATATAAATTTGACAGAGGTATTTCTATTGGAAGATCATTTCAGCATATTTTTTAANTTCTATAAATATATATATANCGGAANC
  3   1   2       chi Ga15      out                      XL415k14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAATCGAAGTGGCGGAGTTCCCCAATATGATTGTCGAAAAATGCGGTTGCACAATGGACAATATCGCTATCATATGACAGATGGCAGCACTAAGTTCATGCAGATCCGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCATGTGTTCAGTGCTGGCAGGGGCCCATTTCGTAAAGTAGGACTGAGCGCCTTTTGGCCTCTCCAGCTTTTAAAAGGATGCTGTGAGTTGTACTTTAACAGCAGGGTTGCAGTTTGGGCAAACTGATGTAATGTGCACCCTGCTGTCACCATCTTGCCCTACTGACAGGTGTTAGTTACTACTGCCTCAAAGGGATGTGGAGGGCCCAGTGCAGCTGCCCCTGCACTTACCCTGAAGACAGCCCTGTTAGCAACGGAACCGTAAGAATATGGTTTTACCTAGACCAAATCTTACTACTCCTTCTGGGAGTTTGTAAAAGCAGCGACAATTTCCGATCTCAGTAATGTCTGTGGCAGAATGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTAATATAGATATTTATCTCTCGTTGACTCAGCCACACTGCGGCATGGAGATGGCTCATAAAATATAAATTTGACAGAGGTATTTCTATTGGAAGATCATTTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)