Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012794965 Xl3.1-IMAGE:6857659.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6857659.5 CCACGCGTCCGCCCACGCGTCCGGTCCGGCAGGTGAGGAGAGCGCACCGCCGACAGAGATGTCTCTAGCTCAGCAGTCCCAGACTTGGTTCCCCACTCACGTCCAGGTTACCGTGTTACAGGCCAAAGGCTTGAAGCCGAAGGGCAAAGCGGGCACCAACGATGCGTATTCCATCATCCAGCTGGGCAAAGAGAAATACTCCACCACCGTGTCGGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACATTCGAGGTGCCGCTGTTACACAATGACAACCAGGAGCGCTGCACCGTGCGCGTTATCGTCATGCACCGAGCGCTGGTGGGAATGGACAAGTTCCTGGGGCAGCTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGAAAAAAAGAAAAGGAACGTGGTCAGATAGAGGTGGAGGTCCAGTTTATGAGAAACAATATGACCGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTGAAAGACAAGATTAAGGGAAAAAGACATGATGGATTCCCAGACACTGCTTCAGCCATCATTCCCAGTGGGAATCAGTACGACAGTGATGAGGAAATACCAGCAGCAGAAAAGAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGACTGAAGAAGAACTCTGTTTCACAGTCCATGTCTGTCTTGCCAACGTTTCCACCATCTTCTCTCTCCAAAAACAGTACTAAAGCCCTGCTGAATTTTCATCAGACTTCACTCCACCTACAGGGTCTCCAGCATCTGGAAAGGCGATTTTCTCATCCTTCCGGTGATCCTGACCCCCCAAAGAGCAGTTTATTGCTGATACCAGCCAAGCTAAACCCAGCCGTCCTCTGGGTAATTAAAAGGAAGGAACTGGCCCC
                                                  Xl3.1-CHK-1012711524       GTCCGCCCACGCGTCCGGTCCGGCAGGTGAGGAGAGCGCACCGCCGACAGAGATGTCTCTAGCTCAGCAGTCCCAGACTTGGTTCCCCACTCACGTCCAGGTTACCGTGTTACAGGCCAAAGGCTTGAAGCCGAAGGGCAAAGCGGGCACCAACGATGCGTATTCCATCATCCAGCTGGGCAAAGAGAAATACTCCACCACCGTGTCGGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACATTCGAGGTGCCGCTGTTACACAATGACAACCAGGAGCGCTGCACCGTGCGCGTTATCGTCATGCACCGAGCGCTGGTGGGAATGGACAAGTTCCTGGGGCAGCTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGAAAAAAAGAAAAGGAACGTGGTCAGATAGAGGTGGAGGTCCAGTTTATGAGAAACAATATGACCGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTGAAAGACAAGATTAAGGGAAAAAGACATGATGGATTCCCAGACACTGCTTCAGCCATCATTCCCAGTGGGAATCAGTACGACAGTGATGAGGAAATACCAGCAGCAGAAAAGAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGACTGAAGAAGAACTCTGTTTCACAGTCCATGTCTGTCTTGCCAACGTTTCCACCATCTTCTCTCTCCAAAAACAGTACTAAAGCCCTGCTGAATTTTCATCAGACTTCACTCCACCTACAGGGTCTCCAGCATCTGGAAAGGCGATTTTCTCATCCTTCCGGTGATCCTGACCCCCCAAAGAGCAGTTTATTGCTGATACCAGCCAAGCTAAACCCAGCCGTCCTCTGGGTAATTAAAAGGAAGGAACT
                                                      consensus depths      1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2
                                               BLH MPR       1      93 
                                                                                                                                       PREDICTED - Sp ---- 7e-008     XP_001178379.1 PREDICTED: similar to GH05001p [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================
                                                                                                                                                                     PROTEIN === Os ==== 1e-009     NP_001062120.1 Os08g0492400 [Oryza sativa (japonica cultivar-group)] ================================================================================================================================================================================================================================================================================================================================
                                                                                                               PROTEIN --- Ag ---- 3e-024     XP_311030.4 AGAP000116-PA [Anopheles gambiae str. PEST] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PROTEIN === Dm ==== 2e-029     NP_573313.2 CG6606-PA [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                 PREDICTED = Bt ==== 7e-071     XP_612748.2 PREDICTED: similar to Rab11 family-interacting protein 2 (Rab11-FIP2) (NRip11) [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                 PREDICTED = Gg ==== 1e-071     XP_421784.1 PREDICTED: similar to KIAA0941 protein; rab11-family interacting protein 2 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                 PREDICTED = Dr ==== 6e-075     NP_001032306.1 hypothetical protein LOC553374 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PREDICTED - ?? ---- 2e-075     XP_597040.3 PREDICTED: similar to RAB11 family interacting protein 1 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PROTEIN --- Mm ---- 4e-076     NP_001074282.1 RAB11 family interacting protein 1 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PREDICTED - Cf ---- 1e-076     XP_857501.1 PREDICTED: similar to Rab coupling protein isoform 1 isoform 2 [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PROTEIN --- Hs ---- 4e-077     NP_001002814.1 Rab coupling protein isoform 3 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                 PROTEIN === Xt ==== 6e-131     CAJ81459.1 novel protein similar to Rab11fip1 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                        PROTEIN === Xl ==== 2e-147     AAH72241.1 LOC432290 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6857659.5                                                           ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   1       add Kid                             IMAGE:4031198.5p CCACGCGTCCGCCCACGCGTCCGGTCCGGCAGGTGAGGAGAGCGCACCGCCGACAGAGATGTCTCTAGCTCAGCAGTCCCAGACTTGGTTCCCCACTCACGTCCAGGTTACCGTGTTACAGGCCAAAGGCTTGAAGCCGAAGGGCAAAGCGGGCACCAACGATGCGTATTCCATCATCCAGCTGGGCAAAGAGAAATACTCCACCACCGTGTCGGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACATTCGAGGTGCCGCTGTTACACAATGACAACCAGGAGCGCTGCACCGTGCGCGTTATCGTCATGCACCGAGCGCTGGTGGGAATGGACAAGTTCCTGGGGCAGCTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGaaaaaaagaaaaGGAACGTGGTCAGATAGAGGTGGAGGTCCAGTTTATGAGAAACAATATGACCGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGANNATTTGAAGACAAGATTAAGGGAAAAAGACATGATGGATTCCCAGACACTGCTTCAGCCATCATTCCCAGTGGGAATCAGTACGACAGTGATGAGGAAATACCAGCAGCAGAAAAGAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGACTGAAGAAGAACTCTGTTTCACAGTCCATGTCTGTCCTGCCAACGTTTCCACCATCTTCCCTCTCAAAAACAAGTACTAAGGGCCTCCTGAAATTCCCATCAGAATTCACCTCCCACCTACAGGGGTCTCCCGGCATCTGAAAAAGGGGATTTTTCTCATTCTTTCCCGGGGGTCCTTGTACCCCCCAAAAGAAGCCCGTTAAATGGGCTGGAAACCCAACCCAAGCTAAATACCAAAGCCCGGTTCTTCTTGGGT
  5   1   2      seed Oo1                             IMAGE:6857659.5p                            GGCAGGTGAGGAGAGCGCACCGCCGACAGAGATGTCTCTAGCTCAGCAGTCCCAGACTTGGTTCCCCACTCACGTCCAGGTTACCGTGTTACAGGCCAAAGGCTTGAAGCCGAAGGGCAAAGCGGGCACCAACGATGCGTATTCCATCATCCAGCTGGGCAAAGAGAAATACTCCACCACCGTGTCGGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACATTCGAGGTGCCGCTGTTACACAATGACAACCAGGAGCGCTGCACCGTGCGCGTTATCGTCATGCACCGAGCGCTGGTGGGAATGGACAAGTTCCTGGGGCAGCTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGaaaaaaagaaaaGGAACGTGGTCAGATAGAGGTGGAGGTCCAGTTTATGAGAAACAATATGACCGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTGAAAGACAAGATTAAGGGAAAAAGACATGATGGATTCCCAGACACTGCTTCAGCCATCATTCCCAGTGGGAATCAGTACGACAGTGATGAGGAAATACCAGCAGCAGAAAAGAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGACTGAAGAAGAACTCTGTTTCACAGTCCATGTCTGTCTTGCCAACGTTTCCACCATCTTCCTCTCCAAAAACAGTACTAAGGCCTGCTGAATTTTCATCAGACTTCACTCCAACTACAGGGTCTCCAGCATCTGAAAAGGCGATTTTCTCATCTTCCCCGTGATCCTGACACACAAAAGAGCAGTTTAGTGCTT
  5   1   2       bld Oo1                             IMAGE:6643621.5p                                                 GCCGACAGAGATGTCTCTAGCTCAGCAGTCCCAGACTTGGTTCCCCACTCACGTCCAGGTTACTGTGTTACAGGCCAAAGGCTTGAAGCCGAAGGGCAAAGCGGGCACCAACGATGCGTATTCCATCATCCAGCTGGGCAAAGAGAAATACTCCACCACCGTGTCGGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACATTCGAGGTGCCGCTGTTACACAATGACAACCAGGAGCGCTGCACCGTGCGCGTTATCGTCATGCACCGAGCGCTGGTGGGAATGGACAAGTTCCTGGGGCAGCTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGAAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAGGTCCAGTTTATGAGAAACAATATGACCGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTGAAAGACAAGATTAAGGGAAAAAGACATGATGGATTCCCAGACACTGCCTCAGCCATCATTCCCAGTGGGAATCAGTACGACAGTGATGAGGAAATGCCAGCAGCAGAAAAGAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGACTGAAGAAGAACTCTATTTCACAGTCCATGTCTGTCTTGCCAACGTTTCCACCATCTTCTCTCTCCAAAAACAGTACTAAAGCCCTGCTGAATTTTCATCAGACTTCACTCCACCTACAGGGTCTCCAGCATCTGGAAAGGCGATTTTCTCATCCTTCCGGTGATCCTGACCCCCCAAAGAGCAGTTTATTGCTGATACCAGCCAAGCTAAACCCAGCCGTCCTCTGGGTAATTAAAAGGAAGGAACTGGCCCCTGGTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)