Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7207565.3                      19 PI      95         52      219                (no blast hit)
     2   0.0    0Xl3.1-XL016c20.3.5                         10 PI      96        102      381                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:4930741-IMAGp.5                10 PI      91         52      187                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8637800.5                       7 PI      83         52      219                (no blast hit)
     5   0.0    0Xl3.1-XL022m02.5                            4 PI      94         61      214                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:4057530-IMAGp.5                 4 PI      93        102      219                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:7207138.3                       3 PI      92         63      188                hypothetical protein LOC446269 [Xenopus laevis]
     8   0.0    0Xl3.1-XL042j18.3                            3 PI      86         53      220                (no blast hit)
     9   0.0    0Xl3.1-xlk72m12ex.3                          3 PI      86         61      220                (no blast hit)
    10   0.0    0Xl3.1-XL080e17.3                            3 PI      81        102      298                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:3556814.3                       2 PI      87        102      244                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012795077 Xl3.1-IMAGE:3580587.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:3580587.5 TGCCATAGACCTTATTTCTGATTGTTTTCACTGCTGACAGTAGTGATATCCATATATATATATAATACACAAAAGCCATGAATATCTTGTAAATTATATCCTTATAAACGGTGAGTTCTGATGTCATCAGTTTCTGTCACATGAGACTCACTGAAACTTGTGTATTATAATAAATAAAGTACCCCCAGTTGCAAAATATGAGGATATTAGAAGTTACCTTCGGCCTTGTGCTTTTATATGGTCATGAAACTCCAATATCCTTATAGTTTACTAGAGGGGGTACTTTATTCACTATATACAGTATGTACAGGACCGTGACGGCCATATTGGCTGTGTGGAGCATCGACTACCAGAAGCTTCCGCTGGGATTCGCTGCTTCGCAACAGCTGGAGAGTCACGTTTGCCACTAATTTTATAGGAATAGGATATTTCTTATTAAAAAAATGTTTTTGGTAG
                                                  Xl3.1-CHK-1012713108       AGACCTTATTTCTGATTGTTTTCACTGCTGACAGTAGTGATATCCATATATATATATAATACACAAAAGCCATGAATATCTTGTAAATTATATCCTTATAAACGGTGAGTTCTGATGTCATCAGTTTCTGTCxCAxxxGACTCACTGAAACTTGTGTATTATAATAAATAAAGTACCCCCAGTTGCAAAATATGAGGATATTAGAAGTTACCTTCGGCCTTGTGCTTTTATATGGTCATGAAACTCCAATATCCTTATAGTTTACTAGAGGGGGTACTTTATTCACTATATACAGTATGTACAGGACCGTGACGGCCATATTGGCTGTGTGGAGCATCGACTACCAGAAGCTTCCGCTGGGATTCGCTGCTTCGCAACAGCTGGAGAGTCACGTTTGCCACTAATTTTATAGGAxxxxxxTATTTCTTATTAAAAAAATGTTTT
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2
                                                 Xl3.1-IMAGE:3580587.5                   TGA---------------------------------------------------------TGA------------------------------TGA------ATG---------------------------------------------------TAA---------------------TGA------TAG---------------------------ATG---ATG---------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------TAG
  5   1   2      seed Tbd5      in                    IMAGE:3580587.5p TGCCATAGACCTTATTTCTGATTGTTTTCACTGCTGACAGTAGTGatatccatatatatatataATACACAAAAGCCATGAATATCTTGTAAATTATATCCTTATAAACGGTGAGTTCTGATGTCATCAGTTTCTGTCACATGACNNTCACTGAAACTTGTGTATTATAATAAATAAAGTACCCCCAGTTGCAAAATATGAGGATATTAGAAGTTACCTTCGGCCTTGTGCTTTTATATGGTCATGAAACTCCAATATCCTTATAGTTTACTAGAGGGGGTACTTTATTCACTATATACAGTATGTACAGGACCGTGACGGCCATATTGGCTGTGTGGAGCATCGACTACCAGAAGCTTCCGCTGGGATTCGCTGCTTCGCAACAGCTGGAGAGTCACGTTTGCCACTAATTTTATAGGATATTTCTTATTAAAAAAATGTTTTTGGTAGAAGCAAAAA
  3   1   2       bld Tbd5      in                    IMAGE:3580587.3p                                                                        CAAAAGCCATGAATATCTTGTAAATTATATCCTTATAAACGGTGAGTTCTGATGTCATCAGTTTCTGTCACATGACTCACTGAAACTTGTGTATTATAATAAATAAAGTACCCCCAGTTGCAAAATATGAGGATATTAGAAGTTACCTTCGGCCTTGTGCTTTTATATGGTCATGAAACTCCAATATCCTTATAGTTTACTAGAGGGGGTACTTTATTCACTATATACAGTATGTACAGGACCGTGACGGCCATATTGGCTGTGTGGAGCATCGACTACCAGAAGCTTCCGCTGGGATTCGCTGCTTCGCAACAGCTGGAGAGTCACGTTTGCCACTAATTTTATAGGATATTTC
  3   1   2       bld Emb4                            IMAGE:4202705.3p                                                                                                                                                                                                                                CCTTGTGCTTTTATATGGTCATGAAACTCCAATATCCTTATAATTTACTAGAGGGGGTACTTTATTCACTATATACAGTATGTACAGGACCGTGACGGCCATATTGGCTGTGCGGAGCATCGACTACCAGAAGCTTCCGNCTGGGATTCGCTGCTTCGCANNACAGNCTGGAGAGNTCACGTTNTGCCACTAATTTTATAGGATATTTCTTATTAAAAAAATGTTTTTGGTAGAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)