Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4959749.3                       6 PI      89        218      363                (no blast hit)

 This cluster: approximate FL confidence score = 54%

 1012795099 Xl3.1-IMAGE:5156271.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5156271.5 GGCGAGTTTCAATTCTACACCCAAATGTGGGTTTTTTGGGGCTTTTTTTAATCCCACTGCGCACCCAATGTATTATTTTAATAATCTATAGGCCCCTGCCACCCAATTTTTTTAACTTGTAAGGGGGGGCCCTGGCACCAATGTTGTTTTAAAAAGATATTTTTTTGGGCCCCACTTTTTTTTAACTTGTGAGGTAGGACCTGGCGCCAATGTTTTTTTTTTTTTTGACTTATAAGGGGTCCCTGGCCATCAATAGCTTTTTATAATGTGTGTGTCGGGGGGGTTACTTTTTTAGCGCTGATGTCTGTGTGGTCTTTCAACTGTGATGTGGAGTGGGCGGGGTTTGGGGTGGGGCTTGGGAGCCAGTGTGGACGGGGCCCCATGATTACTAATAGCGACCCTGGTCCTATGTGATTTACTAAGGGCACATGCCAAGACCTGGGGAGACCTAGTCGCCCAGGGACAAATCGCTCCTCTTCGGACGAATAATCTCCCTGAAAAGCCTTCCTGCTGGTTAGAATCTAGGATTAGTAGTCCGAAGAAGATGCAAATTGTCACCTGGCGACCAAATCTCCCTGAATCCTCACGTGTGCCCTTAGCCTAAGCGTTGCTAAGTTACCTAGTTCCTCAGCAACTGGAAACAGAGCCCAATACTGTAGAATCTATCCGTAGCGCATGCGCAGAGAGAAGAGCGCAAGACTACGAATGCGCAGTCGACAACTTCCTGATACTGATACAACAGGGCCGTGTTCTGTACTTTGCATGTCCGTGAGAGACCTGTGCGACATAACGGTAAAAGGCGGGCGGGCGGAGAGACTGCACAAGAGTTTTGTTGCAGAATGCATCACCTCACGTCAATCACAACCTCCCCAGCTTTTTGGCGTTCCATTCCATGCCAGCGTTCTGAACTTCGACTGGACTACATGCTGGCTTGCGGACAGACATTCCGGTGGAAGGAGTGTAGCCCAGGCTACTGGACTGGAGTGTTAAAAGGGCGTGTGTGGACTATGACGCAGACAGATGAGCATATCTGGTACACAGTGTATACAAAAGACCAGAGTCCTGAAAAGGTTTGTGATGGGTTGAAGGTCACTACAGAGCAAAATAAAAGGAAAAATAACACTGTGCCATGTACCTTGTCAAAGAAGGTAAAAAAGGAGGAAATATTCCCAGAAGATGTGGGGGTAACTGGAGATGTTCCACGCCTTCAGGAAGATGTAGATTGCAAGAAAGACCAAGAGGTGCTGGAAGACTACTTCCAACTTAATGTCAGTCTGAGGACACTCTACCAGCAATGGGAGAGATCAGACCCCGAACTTTCAGAGAGTCGCACAGGATTTTCCAGGTAACAATGACAGTGTTGTATTCCACCAGAATGCCTCTTTTCATTTATTGGCACCTCTAATAACAACATATCTCGCATCACGGGCATGATCGAGCGAGTCTGCAGCTCTCTGGGACAGCGTTTGTGCCAATTGGACTCTGAAGTTTACCACACCTTCCCCACTTTAGAGAAACTGGCAGCAAATGGCACAGAAGCCAAGTTGAGGGATCTGGGCTTTGGGTACAGAGCCAAGTTTGTCAGTGAAAGTGCAAGAACCATCCTATCTAAACATGGCCCTGATTGGTTGGAGAGCTTGCGTCTTGTACCCTATGAAGAAGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTGGGAGCTAAGGTGGCAGACTGTGTATGCCTGATGGCACTTGATAAGTCAGAAGCTGTGCCAGTTGACACCCATGTTTTGCAAATTGCAAAGAGAGACTACGTGCCCCAGCTTGGTGGTTGCAACAAATCACTGACAGATCGAGTGTACAGGGAGACAGGTGATTTTTTCCGTAATTTATGGGGACCCTATGCCGGATGGGCGCAGTCGGTCTTGTTCTGCTCTGAGCTCAAGAAATTCCAAGATCCCACTAATCCCATCAAACCAAAGGGAAACCGGAAAAATCAACAGAAGAAAAAAACAGCAAGTTCTACCTAGGTCATAAGAATTATATTTATATTCAATCAGTTGTTATATGAACTGTACATTGGCATTTCTTGTTTTTACAAACACATTG
                                                  Xl3.1-CHK-1012708687       TTTCAATTCTACACCCAAATGTGGGTTTTTTGGGGCTTTTTTTAATCCCACTGCGCACCCAATGTATTATTTTAATAATCTATAGGCCCCTGCCACCCAATTTTTTTAACTTGTAAGGGGGGGCCCTGGCACCAATGTTGTTTTAAAAAGATATTTTTTTGGGCCCCACTTTTTTTTAACTTGTGAGGTAGGACCTGGCGCCAATGTTTTTTTTTTTTTTGACTTATAAGGGGTCCCTGGCCATCAATAGCTTTTTATAATGTGTGTGTCGGGGGGGTTACTTTTTTAGCGCTGATGTCTGTGTGGTCTTTCAACTGTGATGTGGAGTGGGCGGGGTTTGGGGTGGGGCTTGGGAGCCAGTGTGGACGGGGCCCCATGATTACTAATAGCGACCCTGGTCCTATGTGATTTACTAAGGGCACATGCCAAGACCTGGGGAGACCTAGTCGCCCAGGGACAAATCGCTCCTCTTCGGACGAATAATCTCCCTGAAAAGCCTTCCTGCTGGTTAGAATCTAGGATTAGTAGTCCGAAGAAGATGCAAATTGTCACCTGGCGACCAAATCTCCCTGAATCCTCACGTGTGCCCTTAGCCTAAGCGTTGCTAAGTTACCTAGTTCCTCAGCAACTGGAAACAGAGCCCAATACTGTAGAATCTATCCGTAGCGCATGCGCAGAGAGAAGAGCGCAAGACTACGAATGCGCAGTCGACAACTTCCTGATACTGATACAACAGGGCCGTGTTCTGTACTTTGCATGTCCGTGAGAGACCTGTGCGACATAACGGTAAAAGGCGGGCGGGCGGAGAGACTGCACAAGAGTTTTGTTGCAGAATGCATCACCTCACGTCAATCACAACCTCCCCAGCTTTTTGGCGTTCCATTCCATGCCAGCGTTCTGAACTTCGACTGGACTACATGCTGGCTTGCGGACAGACATTCCGGTGGAAGGAGTGTAGCCCAGGCTACTGGACTGGAGTGTTAAAAGGGCGTGTGTGGACTATGACGCAGACAGATGAGCATATCTGGTACACAGTGTATACAAAAGACCAGAGTCCTGAAAAGGTTTGTGATGGGTTGAAGGTCACTACAGAGCAAAATAAAAGGAAAAATAACACTGTGCCATGTACCTTGTCAAAGAAGGTAAAAAAGGAGGAAATATTCCCAGAAGATGTGGGGGTAACTGGAGATGTTCCACGCCTTCAGGAAGATGTAGATTGCAAGAAAGACCAAGAGGTGCTGGAAGACTACTTCCAACTTAATGTCAGTCTGAGGACACTCTACCAGCAATGGGAGAGATCAGACCCCGAACTTTCAGAGAGTCGCACAGGATTTTCCAGGTAACAATGACAGTGTTGTATTCxxxxxxAATGCCTCTTTTCATTTATTGGCACCTCTAATAACAACATATCTCGCATCACGGGCATGATCGAGCGAGTCTGCAGCTCTCTGGGACAGCGTTTGTGCCAATTGGACTCTGAAGTTTACCACACCTTCCCCACTTTAGAGAAACTGGCAGCAAATGGCACAGAAGCCAAGTTGAGGGATCTGGGCTTTGGGTACAGAGCCAAGTTTGTCAGTGAAAGTGCAAGAACCATCCTATCTAAACATGGCCCTGATTGGTTGGAGAGCTTGCGTCTTGTACCCTATGAAGAAGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTGGGAGCTAAGGTGGCAGACTGTGTATGCCTGATGGCACTTGATAAGTCAGAAGCTGTGCCAGTTGACACCCATGTTTTGCAAATTGCAAAGAGAGACTACGTGCCCCAGCTTGGTGGTTGCAACAAATCACTGACAGATCGAGTGTACAGGGAGACAGGTGATTTTTTCCGTAATTTATGGGGACCCTATGCCGGATGGGCGCAGTCGGTCTTGTTCTGCTCTGAGCTCAAGAAATTCCAAGATCCCACTAATCCCATCAAACCAAAGGGAAACCGGAAAAATCAACAGAAGAAAAAAACAGCAAGTTCTACCTAGGTCATAAGAATTATATTTATATTCAATCAGTTGTTATATGAACTGTACATTGGCATTTCTTGTTTTTACAAACACATTGTATATG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     827     121 
                                               BLH MPR     764     121 
                                               BLH OVR     839     176 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 2e-044     NP_572499.2 CG1795-PA [Drosophila melanogaster] -----------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- ?? ---- 2e-047     XP_629527.1 8-oxoguanine DNA-glycosylase [Dictyostelium discoideum AX4] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ag ---= 1e-065     XP_321213.4 AGAP001854-PA [Anopheles gambiae str. PEST] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ---- 5e-078     XP_001234323.1 PREDICTED: similar to 8-oxoguanine DNA glycosylase [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 1e-081     NP_002533.1 8-oxoguanine DNA glycosylase isoform 1a; 8-hydroxyguanine DNA glycosylase [Homosapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Sp ==== 6e-085     XP_001193234.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 1e-085     XP_541781.2 PREDICTED: similar to N-glycosylase/DNA lyase [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 8e-087     NP_035087.3 8-oxoguanine DNA-glycosylase 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bt ---- 4e-089     NP_001073754.2 8-oxoguanine DNA glycosylase [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 4e-089     XP_001790065.1 PREDICTED: 8-oxoguanine DNA glycosylase [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---= 8e-102     NP_001116780.1 hypothetical protein LOC793885 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 0          AAH97662.1 LOC733253 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5156271.5                                                                                                                        TAA------------------ATG------TAA------------------------------TAA---------TAG------------ATG---------------------------------------------------TAA---------------------------------------------------------TGA---------------------------------------------------------------TAATAG------------------------TAA------ATG------------------TAG---------------------------------------------------------------TAG------------------------------------------------------------------------------TAG------------TAA------TAG---------------------------------TAG------------------------------------------------------------------TGA---TGA---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TGA---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5  -1   1       add Emb1                            IMAGE:5156271.5p GGCGAGTTTCAATTCTACACCCAAATGTGGGttttttggggctttttttAATCCCACTGCGCACCCAATGTATTATTTTAATAATCTATAGGCCCCTGCCACCCAATTTTTTTAACTTGTAAGGGGGGGCCCTGGCACCAATGTTGTTTTAAAAAGATAtttttttgggccccacttttttttaacttgtgaggtaggacctggcgccaatgttttttttttttttGACTTATAAGGGGTCCCTGGCCATCAATAGCTTTTTATAATGTGTGTGTCGGGGGGGTTACTTTTTTAGCGCTGATGTCTGTGTGGTCTTTCAACTGTGATGTGGAGTGGGCGGGGTTTGGGGTGGGGCTTGGGAGCCAGTGTGGACGGGGCCCCATGATTACTAATAGCGACCCTGGTCCTATGTGATTTACTAAGGGCACATGCCAAGACCTGGGGAGACCTAGTCGCCCAGGGACAAATCGCTCCTCTTCGGACGAATAATCTCCCTGAAAAGCCTTCCTGCTGGTTAGAATCTAGGATTAGTAGTCCGAAGAAGATGCAAATTGTCACCTGGCGACCAAATCTCCCTGAATCCTCACGTGTGCCCTTAGCCTAAGCGTTGCTAAGTTACCTAGTTCCTCAGCAACTGGAAACAGAGCCCAATACTGTAGAATCTATCCGTAGCGCATGCGCAGAGAGAAGAGCGCAAGACTACGAATGCGCAGTCGACAACTTCCTGATACTGATACAACAGGGCCGTGTTCTGTACTTTGCATGTCCGTGAGAGACCTGTGCGACATAACGGTAAAAGGCGGGCGGGCGGAGAGACTGCACAAGAGGCGGGTTTATTTGAGAATTTAAAATCGTATTGTTTCCGCCCAAGATCCTTGTTGTTCCGCTCTGCATCGATGAGT
  5   1   2      seed Eye1      in                    IMAGE:6948181.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGATTGAATGCGCAGTCGACAACTTCCTGATACTGATACAACAGGGCCGTGTTCTGTACTTTGCATGTCCGTGAGAGACCTGTGCGACATAACGGTAAAAGGCGGGCGGGCGGAGAGACTGCACAAGAGTTTTGTTGCAGAATGCATCACCTCACGTCAATCACAACCTCCCCAGCTTTTTGGCGTTCCATTCCATGCCAGCGTTCTGAACTTCGACTGGACTACATGCTGGCTTGCGGACAGACATTCCGGTGGAAGGAGTGTAGCCCAGGCTACTGGACTGGAGTGTTAAAAGGGCGTGTGTGGACTATGACGCAGACAGATGAGCATATCTGGTACACAGTGTATACAAAAGACCAGAGTCCTGAAAAGGTTTGTGATGGGTTGAAGGTCACTACAGAGCAAAATAAAAGGAAAAATAACACTGTGCCATGTACCTTGTCAAAGAAGGTAAAAAAGGAGGAAATATTCCCAGAAGATGTGGGGGTAACTGGAGATGTTCCACGCCTTCAGGAAGATGTAGATTGCAAGAAAGACCAAGAGGTGCTGGAAGACTACTTCCAACTTAATGTCAGTCTGAGGACACTCTACCAGCAATGGGAGAGATCAGACCCCGAACTTTCAGAGAGTCGCACAGGATTTTCCAGGTAACAATGACAGTGTTGTATTCTTAACAAGTCTGCATAATGATAGTTAGTTGAGGTTTGACACTATCTCTATCAAATTCAAGCTTCACTCCAACTACCTAGATTATTCTACTTCATaaaaaagaaagggaaaaaTAAGCCCCCCTCTGGAACAATGGTTCAGTTTGGTCGTCTAAGGGAAATAAAAAAACAtgggacgtgtggaattaccctgtgggggggtgtggggaatccccctggggtggggggaattcctccgtggggggaaaacccccggggggtggggaaaaactcctggggtggtgaaaaccccgggggggggggTAATTACCTCTCTAGGGGGGGATAACCTCCTAGGCGGGGGAAATCA
  5   1   2       bld Emb1                            IMAGE:6631801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTGATACAACAGGGCCGTGTTCTGTACTTTGCATGTCCGTGAGAGACCTGTGCGACATAACGTTTTGTTGCAGAATGCATCACCTCACGTCAATCACAACCTCCCCAGCTTTTTGGCGTTCCATTCCATGCCAGCGTTCTGAACTTCGACTGGACTACATGCTGGCTTGCGGACAGACATTCCGGTGGAAGGAGTGTAGCCCAGGCTACTGGACTGGAGTGTTAAAAGGGCGTGTGTGGACTATGACGCAGACAGATGAGCATATCTGGTACACAGTGTATACAAAAGACCAGAGTCCTGAAAAGGTTTGTGATGGGTTGAAGGTCACTACAGAGCAAAATAAAAGGAAAAATAACACTGTGCCATGTACCTTGTCAAAGAAGGTAAAAAAGGAGGAAATATTCCCAGAAGATGTGGGGGTAACTGGAGATGTTCCACGCCTTCAGGAAGATGTAGATTGCAAGAAAGACCAAGAGGTGCTGGAAGACTACTTCCAACTTAATGTCAGTCTGAGGACACTCTACCAGCAATGGGAGAGATCAGACCCGAACTTTCAGAGAGTCGCACAGGATTTTCCAGGTATTCGGGTTTTACGTCAGGACCCCACAGAATGCCTCTTTTCATTTATTTGCACCTCTAATAACAACATATCTCGCATCACGGGCATGATCGAGCGAGTCTGCAGCTCTCTGGGACAGCGTTTGTGGCAATTGGNACTCTGAAGTTTACCACACCTTCCCCACTTTAGAGAAACTGGCAGCAAATGGCACAGAAAGCCAAGTTGAGGGAATCTGGGGCTTTGGGTACAGAACCCAAGTTTTGTTCAGGGAAAGTGCCAAGAACCATCCCTATCTAAACATGGGC
  3   1   1       add Eye1      in                    IMAGE:6948181.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTGATTTCTCAAGGGTGGGGCGGAGAAACCCCCAGGTGGTGTGGATATCTATCATGTGGAGAAATCCCCCAGGGGGGGTATATCAACAGGGGGGGGCCAAACGCACCGGGTCTTATGACACCCCCCTGGAAATTCAGAAATTACCCGTGATGGAAAGGAGTAACTGGTTTGGAAAACCCCATGGGGGGTTAAAAATACTATGGAGGGTGAATTCCATGAAGGGTTTGGAGTACCCGTGAGGTTGATTTTCCTCATTTACCAGAACTATATTTCCCAGGTATTCGGGGTTTACGTCCAGGACCCCACCAGAATGCCTCTTTTCATTTATTGGCACCTCTAATAACAACATATCTCGCATCACGGGCATGATCGAGCGAGTCTGCAGCTCTCTGGGACAGCGTTTGTGCCAATTGGACTCTGAAGTTTACCACACCTTCCCCACTTTAGAGAAACTGGCAGCAAATGGCACAGAAGCCAAGTTGAGGGATCTGGGCTTTGGGTACAGAGCCAAGTTTGTCAGTGAAAGTGCAAGAACCATCCTATCTAAACATGGCCCTGATTGGTTGGAGAGCTTGCGTCTTGTACCCTATGAAGAAGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTGGGAGCTAAGGTGGCAGACTGTGTATGCCTGATGGCACTTGATAAGTCAGAAGCTGTGCCAGTTGACACCCATGTTTTGCAAATTGCAAAGAGAGACTACGTGCCCCAGCTTGGTGGTTGCAACAAATCACTGACAGATCGAGTGTACAGGGAGACAGGTGATTTTTTCCGTAATTTATGGGGACCCTATGCCGGATGGGCGCAGTCGGTCTTGTTCTGCTCTGAGCTCAAGAAATTCCAAGATCCCACTAATCCCATCAAACCAAAGGGAAACCGGAAAAATCAACAGAAGAAAAAAACAGCAAGTTCTACCTAGGTCATAAGAATTATATTTATATTCAATCAGTTGTTATATGAACTGTACATTGGCATTTCTTGTTTTTACAAACACATTGTATATGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)