Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4959749.3                       6 PI      89        218      363                (no blast hit)

 This cluster: approximate FL confidence score = 54%

 1012795099 Xl3.1-IMAGE:5156271.5 - 4 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     827     121 
                                               BLH MPR     764     121 
                                               BLH OVR     839     176 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 2e-044     NP_572499.2 CG1795-PA [Drosophila melanogaster] -----------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- ?? ---- 2e-047     XP_629527.1 8-oxoguanine DNA-glycosylase [Dictyostelium discoideum AX4] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ag ---= 1e-065     XP_321213.4 AGAP001854-PA [Anopheles gambiae str. PEST] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ---- 5e-078     XP_001234323.1 PREDICTED: similar to 8-oxoguanine DNA glycosylase [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 1e-081     NP_002533.1 8-oxoguanine DNA glycosylase isoform 1a; 8-hydroxyguanine DNA glycosylase [Homosapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Sp ==== 6e-085     XP_001193234.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 1e-085     XP_541781.2 PREDICTED: similar to N-glycosylase/DNA lyase [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 8e-087     NP_035087.3 8-oxoguanine DNA-glycosylase 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bt ---- 4e-089     NP_001073754.2 8-oxoguanine DNA glycosylase [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 4e-089     XP_001790065.1 PREDICTED: 8-oxoguanine DNA glycosylase [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---= 8e-102     NP_001116780.1 hypothetical protein LOC793885 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 0          AAH97662.1 LOC733253 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5156271.5                                                                                                                        TAA------------------ATG------TAA------------------------------TAA---------TAG------------ATG---------------------------------------------------TAA---------------------------------------------------------TGA---------------------------------------------------------------TAATAG------------------------TAA------ATG------------------TAG---------------------------------------------------------------TAG------------------------------------------------------------------------------TAG------------TAA------TAG---------------------------------TAG------------------------------------------------------------------TGA---TGA---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TGA---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2      seed Eye1      in                    IMAGE:6948181.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGATTGAATGCGCAGTCGACAACTTCCTGATACTGATACAACAGGGCCGTGTTCTGTACTTTGCATGTCCGTGAGAGACCTGTGCGACATAACGGTAAAAGGCGGGCGGGCGGAGAGACTGCACAAGAGTTTTGTTGCAGAATGCATCACCTCACGTCAATCACAACCTCCCCAGCTTTTTGGCGTTCCATTCCATGCCAGCGTTCTGAACTTCGACTGGACTACATGCTGGCTTGCGGACAGACATTCCGGTGGAAGGAGTGTAGCCCAGGCTACTGGACTGGAGTGTTAAAAGGGCGTGTGTGGACTATGACGCAGACAGATGAGCATATCTGGTACACAGTGTATACAAAAGACCAGAGTCCTGAAAAGGTTTGTGATGGGTTGAAGGTCACTACAGAGCAAAATAAAAGGAAAAATAACACTGTGCCATGTACCTTGTCAAAGAAGGTAAAAAAGGAGGAAATATTCCCAGAAGATGTGGGGGTAACTGGAGATGTTCCACGCCTTCAGGAAGATGTAGATTGCAAGAAAGACCAAGAGGTGCTGGAAGACTACTTCCAACTTAATGTCAGTCTGAGGACACTCTACCAGCAATGGGAGAGATCAGACCCCGAACTTTCAGAGAGTCGCACAGGATTTTCCAGGTAACAATGACAGTGTTGTATTCTTAACAAGTCTGCATAATGATAGTTAGTTGAGGTTTGACACTATCTCTATCAAATTCAAGCTTCACTCCAACTACCTAGATTATTCTACTTCATaaaaaagaaagggaaaaaTAAGCCCCCCTCTGGAACAATGGTTCAGTTTGGTCGTCTAAGGGAAATAAAAAAACAtgggacgtgtggaattaccctgtgggggggtgtggggaatccccctggggtggggggaattcctccgtggggggaaaacccccggggggtggggaaaaactcctggggtggtgaaaaccccgggggggggggTAATTACCTCTCTAGGGGGGGATAACCTCCTAGGCGGGGGAAATCA
  3   1   1       add Eye1      in                    IMAGE:6948181.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTGATTTCTCAAGGGTGGGGCGGAGAAACCCCCAGGTGGTGTGGATATCTATCATGTGGAGAAATCCCCCAGGGGGGGTATATCAACAGGGGGGGGCCAAACGCACCGGGTCTTATGACACCCCCCTGGAAATTCAGAAATTACCCGTGATGGAAAGGAGTAACTGGTTTGGAAAACCCCATGGGGGGTTAAAAATACTATGGAGGGTGAATTCCATGAAGGGTTTGGAGTACCCGTGAGGTTGATTTTCCTCATTTACCAGAACTATATTTCCCAGGTATTCGGGGTTTACGTCCAGGACCCCACCAGAATGCCTCTTTTCATTTATTGGCACCTCTAATAACAACATATCTCGCATCACGGGCATGATCGAGCGAGTCTGCAGCTCTCTGGGACAGCGTTTGTGCCAATTGGACTCTGAAGTTTACCACACCTTCCCCACTTTAGAGAAACTGGCAGCAAATGGCACAGAAGCCAAGTTGAGGGATCTGGGCTTTGGGTACAGAGCCAAGTTTGTCAGTGAAAGTGCAAGAACCATCCTATCTAAACATGGCCCTGATTGGTTGGAGAGCTTGCGTCTTGTACCCTATGAAGAAGCAAAGACTGCACTGTGCTCCCTGCCAGGGGTGGGAGCTAAGGTGGCAGACTGTGTATGCCTGATGGCACTTGATAAGTCAGAAGCTGTGCCAGTTGACACCCATGTTTTGCAAATTGCAAAGAGAGACTACGTGCCCCAGCTTGGTGGTTGCAACAAATCACTGACAGATCGAGTGTACAGGGAGACAGGTGATTTTTTCCGTAATTTATGGGGACCCTATGCCGGATGGGCGCAGTCGGTCTTGTTCTGCTCTGAGCTCAAGAAATTCCAAGATCCCACTAATCCCATCAAACCAAAGGGAAACCGGAAAAATCAACAGAAGAAAAAAACAGCAAGTTCTACCTAGGTCATAAGAATTATATTTATATTCAATCAGTTGTTATATGAACTGTACATTGGCATTTCTTGTTTTTACAAACACATTGTATATGAG

In case of problems mail me! (