Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL144h18.3                            8 END     1          25       12                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012795357 Xl3.1-IMAGE:6638798.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6638798.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATGCCTCCCTGTTTTCCCCCAGCTCCACCTGCATCTGCCCCAGGCAATTCCTCAGCTGTTGTACCTCCTGTTGGACAGTGTCCATATCCTTACATGATGCCGCCAGTTATGCCACCCCCACCAATTATGCCTCCCCCATTACCCCATGTTCCCTATCAAACCCCATATACTGCTGGTTATCCTGCTCAACCGTTTCCTCCACCACCCCCAGCACCCCAACCAACACCAAGCTTTAACAGCTATCAACAGGCGACACCATCTTTTCAAGGTCACTACAGACATGCAAGTCACGGACAATACCAGACAGAAAAGTCACAAGCTGATCACAGAACACAAGAAAGAGGCAAACACTATGAAGATCATCGTCGCAGAGAGTACAGCCATAGTGACAGGCACCGATCTGAAAAACATGGCGACCGCCGAGAGAGAGCCAGAAGCTCTGAAAGGTCAAGAAGACTAGACGGCAGCCGTCACAGGTCAGATTATGAGTATAGGAGGGGACCATCACGTGGTAGAACTTCATCACGCCATCCAAGTTATGAAAGAAGCAGCAGAGAGAGACACCGCCATAGAGAAAGTCGAAGATCATCATCTACTGGAGAGAAGCTATAGGAAGAGGCCAAAAAGTACATCACCATCAAGCAGAGAGCATAAAAGATCTCGGTGGGAGGAAGATACCGAATCTCTATCAGAGAGCCCCTCTTCAACAAAAGAAAAGTCCAGCATTTCTGTTAAAGATAAGGATTCTCTGGATGAAAACCTATTGGAAAGAAATGAGGAAGCAGATGAAGAATTGCTTAAACCAGTGTGGGTTCGTTGCACCCATTCTGAGAGTTACTACTCAAGTGACCCCATGGATCAAGTTGGAGACTCCACAGTAGTTGGCACAAGCAGACTACGTGATTTATATGACAAGTTTGAAGAGGAGCTTGGAAAGCGTCAGACAACAGCTAGAGCTGCCAGGCCAGCATGGGAGCCGCCAAAGACCAAATTAGATGAGGATCTAGAGAGTTCCAGTGACTCTGAGTGTGAAACGGATGATAGCTGCTCCAGCAGTTCAGATTCAGACGTGTTTGATGTAATCGCAGAAATAAAAAGGAAAAAAGCACACCCTGACCGCCTTCATGAAGAGCTGTGGTATAATGACCCTGGGCAGATGAATGATGGACCTCTCTGTAAGTGCAGTTTGAAAGCTAGACGGACTGGAATAAGGCATAGCATTTACCCTGGAGAGGAGCTTACAAAAAGCTTGTCGCCCAATGACAAACAATGCAGGACGGCTTTTTCCACTACAGGATAACAGTGTCTCCACCAACGAATTTCTTGACTGACCGGCCAACTGTTATTGAGTATGATGATCATGAGTATATATTTGAAAGTTTTTTCCAAGTTTTTCACATTTCTCCCTCTTGAAAAAAGGGTTCCCCCCTGTTGGCAAAAGTAAATTCCCGGGTTTTTACCCTTTGGAATTTACCCCCGATTGCAC
                                                  Xl3.1-CHK-1012709694                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCCTGTTTTCCCCCAGCTCCACCTGCATCTGCCCCAGGCAATTCCTCAGCTGTTGTACCTCCTGTTGGACAGTGTCCATATCCTTACATGATGCCGCCAGTTATGCCACCCCCACCAATTATGCCTCCCCCATTACCCCATGTTCCCTATCAAACCCCATATACTGCTGGTTATCCTGCTCAACCGTTTCCTCCACCACCCCCAGCACCCCAACCAACACCAAGCTTTAACAGCTATCAACAGGCGACACCATCTTTTCAAGGTCACTACAGACATGCAAGTCACGGACAATACCAGACAGAAAAGTCACAAGCTGATCACAGAACACAAGAAAGAGGCAAACACTATGAAGATCATCGTCGCAGAGAGTACAGCCATAGTGACAGGCACCGATCTGAAAAACATGGCGACCGCCGAGAGAGAGCCAGAAGCTCTGAAAGGTCAAGAAGACTAGACGGCAGCCGTCACAGGTCAGATTATGAGTATAGGAGGGGACCATCACGTGGTAGAACTTCATCACGCCATCCAAGTTATGAAAGAAGCAGCAGAGAGAGACACCGCCATAGAGAAAGTCGAAGATCATCATCTACTGxxxxxAAGCTATAGGAAGAGGCCAAAAAGTACATCACCATCAAGCAGAGAGCATAAAAGATCTCGGTGGGAGGAAGACACCGAATCTCTATCAGAGAGCCCCTCTTCAACAAAAGAAAAGTCCAGCATTTCTGTTAAAGATAAGGATTCTCTGGATGAAAACCTATTGGAAAGAAATGAGGAAGCAGATGAAGAATTGCTTAAACCAGTGTGGGTTCGTTGCACCCATTCTGAGAGTTACTACTCAAGTGACCCCATGGATCAAGTTGGAGACTCCACAGTAGTTGGCACAAGCAGACTACGTGATTTATATGACAAGTTTGAAGAGGAGCTTGGAAAGCGTCAGACAACAGCTAGAGCTGCCAGGCCAGCATGGGAGCCGCCAAAGACCAAATTAGATGAGGATCTAGAGAGTTCCAGTGACTCTGAGTGTGAAACGGATGATAGCTGCTCCAGCAGTTCAGATTCAGACGTGTTTGATGTAATCGCAGAAATAAAAAGGAAAAAAGCACACCCTGACCGCCTTCATGAAGAGCTGTGGTATAATGACCCTGGGCAGATGAATGATGGACCTCTCTGTAAGTGCAGTTTGAAAGCTAGACGGACTGGAATAAGGCATAGCATTTACCCTGGAGAGGAGCTTACAAAAAGCTTGTCGCCCAATGACAAACAATGCAGGACGGCTTTTTCCACTACAGGATAACAGTGTCTCCACCAACGAATTTCTTGACTGACCGGCCAACTGTTATTGAGTATGATGATCATGAGTATATATTTGAAAGTTTTTTCCAAGTTTTTCACATTTCTCCCTCTTGAAAAAAGGGTTCCCCCCTGTTGGCAAAAGTAAATTCCCGGGTTTTTACCCTTTGGAATTTACCCCCGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     1     2     2     2     2     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1
                                               BLH MIN     576     105                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Ce ---- 5e-007     NP_871988.1 putative nuclear protein (2D362) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 3e-007     XP_001183393.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- At ---- 2e-008     NP_193252.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein [Arabidopsis thaliana] --------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 8e-009     XP_629749.1 putative protein serine/threonine kinase [Dictyostelium discoideum AX4] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 2e-009     NP_477436.1 CG8730-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 2e-041     XP_555381.3 AGAP008087-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 1e-081     NP_001103942.1 hypothetical protein LOC567505 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Mm ---- 1e-110     XP_001473806.1 PREDICTED: similar to ribonuclease III, nuclear [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 1e-112     NP_001093882.1 ribonuclease III, nuclear isoform 2 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Cf ---- 5e-113     XP_536514.2 PREDICTED: similar to Ribonuclease III (RNase III) (Drosha) (p241) isoform 1 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - ?? ---- 2e-113     XP_591998.4 PREDICTED: similar to ribonuclease III, nuclear [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Gg ---- 3e-114     NP_001006379.1 similar to Etohi2 protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ---- 0          NP_001107152.1 ribonuclease type III, nuclear [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 0          AAH92388.1 Unknown (protein for IMAGE:6327235) [Xenopus laevis] -------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6638798.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG------------------------------------------------------------------------------------------ATGATG---------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------TAA------------------------------------------------------------------------------TAA---TAA------------TGA------------------TGA---------TGA---------TAA---------------------------TGA---------------TGA---------------------------------------------------TGA------TGA------TGA------------------------------TAG---------------ATG------------------------TGA------------------TGA---TGA---TGA------TGATAG------------------------------TGA------------------------------------TGA---------TGA------------TAATGA---------------TGA------------TAA---------------TAG------------------TAG------------------------------------------TGA------ATG------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                    ...
  5   1   1       add Emb4                            IMAGE:5570984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATGCCTCCCTGTTTTCCCCCAGCTCCACCTGCATCTGCCCCAGGCAATTCCTCAGCTGTTGTACCTCCTGTTGGACAGTGTCCATATCCTTACATGATGCCGCCAGTTATGCCACCCCCACCAATTATGCCTCCCCCATTACCCCATGTTCCCTATCAAACCCCATATACTGCTGGTTATCCTGCTCAACCGTTTCCTCCACCACCCCCAGCACCCCAACCAACACCAAGCTTTAACAGCTATCAACAGGCGACACCATCTTTTCAAGGTCACTACAGACATGCAAGTCACGGACAATACCAGACAGAAAAGTCACAAGCTGATCACAGAACACAAGAAAGAGGCAAACACTATGAAGATCATCGTCGCAGAGAGTACAGCCATAGTGACAGGCACCGATCTGAAAAACATGGCGACCGCCGAGAGAGAGCCAGAAGCTCTGAAAGGTCAAGAAGACTAGACGGCAGCCGTCACAGGTCAGATTATGAGTATAGGAGGGGACCATCACGTGGTAGAACTTCATCACGCCATCCAAGTTATGAAAGAAGCAGCAGAGAGAGACACCGCCATAGAGAAAGTCGAAGATCATCATCTACTGAGAGAAGCTATAGAAAAAGGCCAAAAAGTCCATCACCATCAAGTAGAGAGCATAAAAGATCTCGNGTGNGAGGAAGATACCGAATCTCTATCAGAGAGCCCCTCTTCAACAAAAGAAAAGCCCAGCATTTCTGTTANAGATAAAGATTCTCTGGATGAAAACCTATTGGAAAGAAATGAAGAAGAAGATGAAGAATGCTTAAAACCANggggggggTTCCTTGTACCCATTTCTGAAAATTACTACTCTAGTGAACCCATGGGATC
  5   1   2      seed Oo1                             IMAGE:6638798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGTAAACCGGTCCGGAATTCCCGTGCATCGAAGATCAACATCTACTGAGAGAAGCTATAGGAAGAGGCCAAAAAGTACATCACCATCAAGCAGAGAGCATAAAAGATCTCGGTGGGAGGAAGACACTGCATCTCTATCAGAGAGCTCCTCATCAGCAAAAGAAAAGTCCAGCATTTCTGTTAAAGATAAGGATTCTTTGGATGAAAACCTATTTGAAAGAAATGAGGAAGCAGATGAAGAATTGCTTAAACCAGTGTGGGTTCGTTGCACCCATTCTGAGAGTTACTACTCAAGTGACCCCATGGATCAAGTTGGAGACTCCACAGTAGTTGGCACAAGCAGACTACGTGATTTATATGACAAGTTTGAAGAGGAGCTTGGAAAGCGTCAGACAACAGCTAGAGCTGCCAGGCCAGCATGGGAGCCGCCAAAGACCAAATTAGATGAGGATCTAGAGAGTTCCAGTGACTCTGAGTGTGAAACGGATGATAGCTGCTCCAGCAGTTCAGATTCAGACGTGTTTGATGTAATCGCAgaaataaaaaggaaaaaaGCACACCCTGACCGCCTTCATGAAGAGCTGTGGTATAATGACCCTGGGCAGATGAATGATGGACCTCTCTGTAAGTGCAGTTTGAAAGCTAGACGGACTGGAATAAGGCATAGCATTTACCCTGGAGAGGAGCTTACAAAAAGCTTGTCGCCCAATGACAAACAATGCAGGACGGCTTTTTCCACTACAGGATAACAGTGTCTCCACCAACGAATTTCTTGACTGACCGGCCAACTGTTATTGAGTATGATGATCATGAGTATATATTTGAAAGTTTTTTCCAAGTTTTTCACATTTCTCCCTCTTGAAAAAAGGGTTCCCCCCTGTTGGCAAAAGTAAATTCCCGGGTTTTTACCCTTTGGAATTTACCCCCGATTGCACATTTC
  5   1   1       add Brn1      out                   IMAGE:6950463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGTCGAAGATCATCATCTACTGGAGAGAAGCTATAGAAAAAGGCCAAAAAGTCCATCACCATCAAGTAGAGAGCATAAAAGATCTCGGTGGGAGGAAGATACCGAATCTCTATCAGAGAGCCCCTCTTCAACAAAAGAAAAGTCCAGCATTTCTGTTAAAGATAAGGATTCTCTGGATGAAAACCTATTGGAAAGAAATGAGGAAGAAGATGAAGAATTGCTTAAGCCAGTGTGGGTTCGTTGTACCCATTCTGAGAGTTACTACTCTAGTGACCCAATGGATCAAGTTGGAGACTCCACAGTGGTTGGCACAAGCAGACTACGTGATTTATATGACAAGTTTGAAGAGGAGCTTGGAAAGCGTCAGACAACAGCTAGAGCTGCCAAGCCAGCATGGGAGCCGCCAAAGACCAAATTAGATGAGGATCTGGAGAGTTCCAGTGAGTCAGAGTGTGAAATGGATGATAGCTGCTCCAGCAGTTCAGATTCAGAGCTCTTTGATGTAATCGAGgaaataaaaaggaaaaaaGCGCACCCCGATCGCCTTCATGAAGAGCTCTGGTATAATGACCCTGGGCAGATGAACGATGGTCCTCTCTGTAAGTGCAGTTTGAAAGCCAGACGGAATGGAATCAGGCATAGCATTTACCCAGCGGAAGAGTCTATTAAAGCATGTCGCCCCATGGACAACAATGCAGGACGGCTTTTTCACTACCGGGATAACGTGTCTCCGCCCACTAACTTCTTGACTGAACGGGCCAACTGTTATTGGATATGGAGGATCATGAGTTAATCTTTTGAAGGTTTATCCATGGTTTTCGCATTCCCCTCCTGAACAAATTTTTCCCCTGTGCAAAGTAAATCCGGGTTTAACATTGACCT
  5   1   2       bld Oo1                             IMAGE:3404795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTCCTCATCAGCAAAAGAAAAGTCCAGCATTTCTGTTAAAGATAAGGATTCTTTGGATGAAAACCTATTTGAAAGAAATGAGGAAGCAGATGAAGAATTGCTTATACCAGTGTGGGTTCGTTGCACCCATTCTGAGAGTTACTACTCAAGTGACCCCATGGATCAAGTTGGAGACTCCACAGTAGTTGGCACAAGCAGACTACGTGATTTATATGACAAGTTTGAAGAGGAGCTTGGAAAGCGTCAGACAACAGCTAGAGCTGCCAGGCCAGCATGGGAGCCGCCAAAGACCAAATTAGATGAGGATCTAGAGAGTTCCAGTGACTCTGAGTGTGAAACGGATGATAGCTGCTCCAGCAGTTCAGATTCAGACGTGTTTGATGTAATCGCAgaaataaaaaggaaaaaaGCACACCCTGACCGCCTTCATGAAGAGCTGTGGTATAATGACCCTGGGCAGATGAATGATGGACCTCTCTGTAAGTGCAGTTTGAAAGCTAGACGGACTGGAATAAGGCATAGCATTTACCCTGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)