Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012795513 Xl3.1-XL207j09.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL207j09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGAAATCATAGAGGNCCCAGACGATCAAGGCTGGGATCCGATGGATTGCTGTTAATCGATTTTGAAATTTGCTTCTTTGGCTCATTCACTGACATGACACTCGATGATCTTGAGTGGATGGTGTCTGAGTGTGGAGCCACTGTGGTGAAAAAACTTCAGTTCTTTAAAAAGAAACACAATGTGACATTGCTTGTGATTGTGCAACCTGATGCTAGTACAGAAGTCCGAGATTATACTGAGATCAGGAAGAAGCACAAGGCACTAGTAGTGACGCGTGAGTGGTTAATGGACAGTGTTGTACTTACAGACTTCAGAAGTTTGATGCTTACCTTGCATAAAATCACAGTGGAACTGGCCGGTTATGATACGCGTCTAGCTCTTATCCTTTCACTATCTACAAGTGCCTTCTTTACATTCTTATATAATTCGCTGTCTACCGAAATGCACTGATATAAGCTGTGTTAGCATCTTCATCACAACAGGTTTGAAGAGAACAGTTAGGATGGGGTTCTCACAAAAGTTTTTGATGCTCTAGTTAAAGGAATGTTTGCCTAGGAGCAACAAAAAACCTTATAAGGAGGAAGATCGAGCTTCTATCAGATTCCATTACACAGTTTAGTTGGTTACTATGGCCTAAGCTTTTGAGTCTGGCCCCTATGTGGAGACCTGAAGCAGTGGCATGAGGACTTAGCCTTTAGGTGATTTAGGGTAAAGTGTGTAGACTTCCTAAGTGCTGTCCTATATCTGAATGTCTTGCTTGAAGTCTGGTTCGGGTGAGATTAGAAGACAATGCCTATTTGTTCTAGAAACTGAAATCCAAGCTTGAAGTCCAGTTAGAGAAAGATTAGGGGACAATGTAAGTTTGTGCTAGATATGCCTAAAAGCCCAGTTTGAAGTCTAGTAATAGTGAAGTTTGGGGAGAATGCAGTTTGTTCTCTGAGATATACCTGAAAGCCCA
                                                  Xl3.1-CHK-1012713766                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCATAGAGGNCCCAGACGATCAAGGCTGGGATCCGATGGATTGCTGTTAATCGATTTTGAAATTTGCTTCTTTGGCTCATTCACTGACATGACACTCGATGATCTTGAGTGGATGGTGTCTGAGTGTGGAGCCACTGTGGTGAAAAAACTTCAGTTCTTTAAAAAGAAACACAATGTGACATTGCTTGTGATTGTGCAACCTGATGCTAGTACAGAAGTCCGAGATTATACTGAGATCAGGAAGAAGCACAAGGCACTAGTAGTGACGCGTGAGTGGTTAATGGACAxxxTxxTACTTACAGACTTCAGAAGTTTGATGCTTACCTTGCATAAAATCACAGTGGAACTGGCCGGTTATGATACGCGTCTAGCTCTTATCCTTTCACTATCTACAAGTGCCTTCTTTACATTCTTATATAATTCGCTGTCTACCGAAATGCACTGATATAAGCTGTGTTAGCATCTTCATCACAACAGGTTTGAAGAGAACAGTTAGGATGGGGTTCTCACAAAAGTTTTTGATGCTCTAGTTAAAGGAATGTTTGCCTAGGAGCAACAAAAAACCTTATAAGGAGGAAGATCGAGCTTCTATCAGATTCCATTACACAGTTTAGTTGGTTACTATGGCCTAAGCTTTTGAGTCTGGCCCCTATGTGGAGACCTGAAGCAGTGGCATGAGGACTTAGCCTTTAGGTGATTTAGGGTAAAGTGTGTAGACTTCCTAAGTGCTGTCCTATATCTGAATGTCTTGCTTGAAGTCTGGTTCGGGTGAGATTAGAAGACAATGCCTATTTGTTCTAGAAACTGAAATCCAAGCTTGAAGTCCAGTTAGAGAAAGATTAGGGGACAATGTAAGTTTGTGCTAGATATGCCTAAAAGCCCAGTTTGAAGTCTAGTAATAGTGAAGTTTGGGGAGAATGCAGTTTGTTCTCTGAGATATACCTGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     1     2     1     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1
                                                                       ...PROTEIN --- Mm ---- 3e-011     NP_033894.3 breast cancer 1 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cf ---- 8e-018     NP_001013434.1 breast and ovarian cancer susceptibility protein 1 [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 1e-019     NP_848668.1 breast cancer 1, early onset [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 9e-021     NP_009236.1 breast cancer 1, early onset isoform BRCA1-delta9-10-11b [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-023     NP_989500.1 breast cancer 1, early onset [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-040     NP_001107963.1 breast cancer 1, early onset [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 8e-054     NP_001084248.1 breast and ovarian cancer susceptibility protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL207j09.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---TGA------------TAG---------------------------------TAG------------------------------------------ATG------TAG------------------TAA------------------------------------------------------------------TGA------------------------------------------------------TGA------------------------------------------------------------------------TGA---TAG------ATG------------------TGA---------------------TAG------------------------------------ATG---------------TGA------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                              ...
  5   1   2      skin Ga18                              xlk149a14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGAAATCATAGAGGNCCCAGACGATCAAGGCTGGGATCCGATGGATTGCTGTTAATCGATTTTGAAATTTGCTTCTTTGGCTCATTCACTGACATGACACTCGATGATCTTGAGTGGATGGTGTCTGAGTGTGGAGCCACTGTGGTGAAAAAACTTCAGTTCTTTAAAAAGAAACACAATGTGACATTGCTTGTGATTGTGCAACCTGATGCTAGTACAGAAGTCCGAGATTATACTGAGATCAGGAAGAAGCACAAGGCACTAGTAGTGACGCGTGAGTGGTTAATGGACAGTGTTGCTACTTACAGACTTCAGAAGTTTGATGCTTACCTTGCATAAAATCACAGTGGAACTGGCCGGTTATGATACGCGTCNNNNCTTATCCTTTCACTATCTACAAGTGCCTTCTTTACATTCTTATATAATTCGCTGTCTACCGAAATGCACTGATATAAGCTGTGTTAGCATCTTCATCACAACAGGTTTGAAGAGAACAGTTAGGATGGGGTTCTCACAAAAGTTTTTGATGCTCTAGTTAAAGGAATGTTTGCCTAGGAGCAACAAAAAACCTTATAAGGAGGAAGATCGAGCTTCTATCAGATTCCATTACACAGTTTAGTTGGNTACTATGGCCTAAGCTTTTGAGTCTGGCCCCTATGTGGAGANCTGAAGCAGTGGNACGAGGACTTAGCCTTTAGGTGATTTAGGGTAAAGTGTGTAGACTTCCTAAGTGCTGTCCTATATCTGAATGTCTTGCTTGAAGTCTGGTTCGGGTGAGANTAGAAGANAATGCCTATTTGTTCTAGAAACTGAAATCCAAGCTTGAAGTCCAGTTAGAGAAAGNNTAGGGGANNATGTAAGTTTGTTCTAGATATGCCTAAAAGCCCAGTTTGAAGTCTAGNAATAGTGAAGTTTGGGGNGNATGC
  5   1   2      seed Tbd7      out                        XL094c02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGCAACCTGATGCTAGTACAGAAGTCCGAGNATTATACTGAGATCAGGAAGAAGCACAAGGCACTAGTAGTGACGCGTGAGTGGTTAATGGACAGTGTTGCTACTTACAGACTTCAGAAGTTTGATGCTTACCTTGCATAAAATCACAGTGGAACTGGCCGGTTATGATACGCGTCTAGCTCTTATCCTTTCACTATCTACAAGTGCCTTCTTTACATTCTTATATAATTCGCTGTCTACCGAAATGCACTGATATAAGCTGTGTTAGCATCTTCATCACAACAGGTTTGAAGAGAACAGTTAGGATGGGGTTCTCACAAAAGTTTTTGATGCTCTAGTTAAAGGAATGTTTGCCTAGGAGCAACAAAAAACCTTATAAGGAGGAAGATCGAGCTTCTATCAGATTCCATTACACAGTTTAGTTGGTTACTATGGCCTAAGCTTTTGAGTCTGGCCCCTATGTGGAGACCTGAAGCAGTGGCACGAGGACTTAGCCTTTAGGTGATTTAGGGTAAAGTGTGTAGACTTCCTAAGTGCTGTCCTATATCTGAATGTCTTGCTTGAAGTCTGGTTCGGGTGAGATTAGAAGACAATGCCTATTTGTTCTAGAAACTGAAATCCAAGCTTGAAGTCCAGTTAGAGAAAGATTA
  5   1   2       bld Ga12      out                        XL207j09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTTGCTACTTACAGACTTCAGAAGTTTGATGCTTACCTTGCATAAAATCACAGTGGAACTGGCCGGTTATGATACGCGTTTAGCTCTTATCCTGTCACTATCTACAAGTGCCTTCTTTACATTCTTATATAATTCGCTGTCTACCTAAATGCACTGATAAAAGCTGTGTTAGCATCTTCATCACAACAGGTTTGAAGAGAACATTTAGGATGGGGTTCTCACAAAAGTTTTTGATGCTCTAGTTAAAGGAATGTTTGCCTAGGAGCAACAAAAAACCTTATAAGGAGGAAGATCGAGCTTCTATCAGATTCCATTACACAGTTTAGTTGGTTACTATGGCCTAAGCTTTTGAGTCTGGCCCCTATGTGGAGACCTGAAGCAGTGGCATGAGGACTTAGCCTTTAGGTGATTTAGGGTAAAGTGTGTAGACTTCCTAAGTGCTGTCCTATATCTGAATGTCTTGCTTGAAGTCTGGTTCGGGTGAGATTAGAAGACAATGCCTATTTGTTCTAGAAACTGAAATCCAAGCTTGAAGTCCAGTTAGAGAAAGATTAGGGGACAATGTAAGTTTGTGCTAGATATGCCTAAAAGCCCAGTTTGAAGTCTAGTAATAGTGAAGTTTGGGGAGAATGCAGTTTGTTCTCTGAGATATACCTGAAAGCCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)