Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:8740950.5.5                    21 END     1          16        4                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012795707 Xl3.1-rxl253e23.3 - 6 ESTs
                                                                       ........-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xl3.1-rxl253e23.3                                                           AGAAGAGGCAAATAAAGAATAGAAAGAAATGCTGAAGTGTACAATGTATCAGACAGGAATATGAGGAATAAACAACTGCAGCACATGAAGTCCAACGAGTAAATGGAGAAGGCCAGTGAGTGACGTCAGACGTTACGCAATCATACAGCTGTAGGGCAGGGACTTCCGGGAGACTTGAAAGCTGCGACTCACGGGAGAACCAACATAGTGGTAACCGCCTCCCACATTTTGAATGACAGGAGCAAACAGCCAATAGCGTAGGCTGTCAACAAATGTTCAGAGGCGTCTTGGTCTCCATGGAGACCGCGGATTCCACCTCTCCCGGAAGGGATTGCTCAGTAGCCAATCGGAGGAGGAGATGGTACCAAGAGCGGATGTCCGGCTGTTGTGTGTTTGTCTGGCTGCCGGCACGTGAATCCGGATGTTGAAGGGAAGCGAGTAGAGAAATAAAAGAGAGGTATAAAGAGGTTTCGCTTCCGCACGATCATGTACGCCGTGTACCGACAAGCGCACCCGCCCACCGGCCTGGAGTTCTCCATGTCCTGCAACTTCTTCAACAACTCCGAGCGGAACCTGGTGGTGGCGGGAACCTCGCAGCTCTACGTGTATCGGCTCAACCCGAGCTCTGAGAGCTCGTCCAAAGGGGAGTCCGTGTCAGAGGTGAAGGGTCACAAGGAGAAGCTGGAGCTCATGGCCTCCTTCTCCTTCTTCGGTAACATCATGTCTATGGCCAGTGTCCAGTTGGCTGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTCAAGGAGGCCAAGCTCTCAGTCGTGGAGTACGACCCCGGGACCCATGATCTCAAGACTCTGTCCTTACATTACTTTGAGGAGCCAGAACTGCGGGACGGATTTGTGCAGAACGTTCACATCCCTAAAGTGCGTGTGGACCCCAGTGGGCGCTGCGCTGTCATGTTGATCTATGGCACCCAGCTGGTTGTTCTGCCCTTTCGGAGGGATACCCTGGCAGAGGAGCACGAAGGACTGGTGGGAGAAAGGCAGAAAAGTCCAGTTTCTTGCCCAGTTATATCATCGACGTGAGGGAACTGGATGAGAAGCTGCTGAATATCATTGATATGCAATTCCTCCATGGCTACTATGAGCCCACCCTCC
                                                  Xl3.1-CHK-1012702837                                                                 GGCAAATAAAGAATAGAAAGAAATGCTGAAGTGTACAATGTATCAGACAGGAATATGAGGAATAAACAACTGCAGCACATGAAGTCCAACGAGTAAATGGAGAAGGCCAGTGAGTGACGTCAGACGTTACGCAATCATACAGCTGTAGGGCAGGGACTTCCGGGAGACTTGAAAGCTGCGACTCACGGGAGAACCAACATAGTGGTAACCGCCTCCCACATTTTGAATGACAGGAGCAAACAGCCAATAGCGTAGGCTGTCAACAAATGTTCAGAGGCGTCTTGGTCTCCATGGAGACCGCGGATTCCACCTCTCCCGGAAGGGATTGCTCAGTAGCCAATCGGAGGAGGAGATGGTACCAAGAGCGGATGTCCGGCTGTTGTGTGTTTGTCTGGCTGCCGGCACGTGAATCCGGATGTTGAAGGGAAGCGAGTAGAGAAATAAAAGAGAGGTATAAAGAGGTTTCGCTTCCGCACGATCATGTACGCCGTGTACCGACAAGCGCACCCGCCCACCGGCCTGGAGTTCTCCATGTCCTGCAACTTCTTCAACAACTCCGAGCGGAACCTGGTGGTGGCGGGAACCTCGCAGCTCTACGTGTATCGGCTCAACCCGAGCTCTGAGAGCTCGTCCAAAGGGGAGTCCGTGTCAGAGGTGAAGGGTCACAAGGAGAAGCTGGAGCTCATGGCCTCCTTCTCCTTCTTCGGTAACATCATGTCTATGGCCAGTGTCCAGTTGGCTGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTCAAGGAGGCCAAGCTCTCAGTCGTGGAGTACGACCCCGGGACCCATGATCTCAAGACTCTGTCCTTACATTACTTTGAGGAGCCAGAACTGCGGGACGGATTTGTGCAGAACGTTCACATCCCTAAAGTGCGTGTGGACCCCAGTGGGCGCTGCGCTGTCATGTTGATCTATGGCACCCAGCTGGTTGTTCTGCCCTTTCGGAGGGATACCCTGGCAGAGGAGCACGAAGGACTGGTGGGAGAAAGGCAGAAAxxxCxxGTTTCTTGCCCAGTTATATCATCGACGTGAGGGAACTGGATGAGAAGCTGCTGAATATCATTGATATGCAATTCCTCCATGGCTACTATGAGCCCA
                                                      consensus depths                                                                2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     3     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     1     4     1     4     1     4     1     4     1     4     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     2     4     3     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3
                                               BLH ATG     486     478                                                           
                                               BLH MIN     486      81                                                           
                                               BLH MPR     303      81                                                           
                                               BLH OVR     486     860                                                           
                                               CDS MIN     486      81                                                           
                                               ORF LNG     486      23                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 2e-015     NP_001108153.1 cleavage and polyadenylation specific factor 1 [Danio rerio] ===================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- At ---- 4e-020     NP_199979.2 cleavage and polyadenylation specificity factor (CPSF) A subunit C-terminal domain-containing protein [Arabidopsis thaliana] ------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Ce ==== 2e-027     NP_500157.2 cleavage polyadenylation specific factor 1 160kDa (4C774) [Caenorhabditiselegans] ===========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- ?? ---- 3e-026     XP_640515.1 CPSF domain-containing protein [Dictyostelium discoideum AX4] ==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Ag ==== 2e-057     XP_309311.4 AGAP011340-PA [Anopheles gambiae str. PEST] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 4e-057     XP_001183188.1 PREDICTED: similar to LOC564406 protein [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 2e-057     NP_995833.1 CG10110-PA, isoform A [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Cf ---- 4e-074     XP_532356.2 PREDICTED: similar to cleavage and polyadenylation specific factor 1 [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bt ==== 1e-100     NP_777145.1 cleavage and polyadenylation specific factor 1, 160kDa [Bos taurus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 1e-101     NP_444423.1 cleavage and polyadenylation specificity factor 1; CPSF160 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 7e-102     NP_037423.2 cleavage and polyadenylation specific factor 1, 160kDa [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Xl ==== 9e-117     AAH60475.1 Unknown (protein for IMAGE:4032917) [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xl3.1-rxl253e23.3                                                                       TAA---------------------------------------------ATG---------------------ATG------------TAAATG---------------TGA---------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------TAA------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TGA---------ATG---------TGA------------------------ATG------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  3  -1   2       bld Egg2                            IMAGE:5162640.3p TATTTGTGTTTATTAGATGGGGTCAGTGACCCCCATTTGAGAGGTGGAAAGAGTTCGGAGAAGAGGCAAATAAAGAATAGAAAGAAATGCTGAAGTGTACAATGTATCAGACAGGAATATGAGGAATAAACAACTGCAGCACATGAAGTCCAACGAGTAAATGGAGAAGGCCAGTGAGTGACGTCAGACGTTACGCAATCATACAGCTGTAGGGCAGGGACTTCCGGGAGACTTGAAAGCTGCGACTCACGGGAGAACCAACATAGTGGTAACCGCCTCCCACATTTTGAATGACAGGAGCAAACAGCCAATAGCGTAGGCTGTCAACAAATGTTCAGAGGCGTCTTGGTCTCCATGGAGACCGCGGATTCCACCTCTCCCAGAAGGGATTGCTCAGTAGCCAATCGGAGGAGGAGATGGTACCAAGAGCGGATATCCGGCTGTTGTGTGTTTGTCTGGCTGCCGGCACGTGAATCCGGATGTTGAAGGGAAGCGAGTAGAGAAAT
  3  -1   2      seed DMZ                                 rxl253e23.3p                       CCCATTTGAGAGGTGGAAAGAGTTCGGAGGAGAAGAAGAAGAGGCAAATAAAGAATAGAAAGAAATGCTGAAGTGTACAATGTATCAGACAGGAATATGAGGAATAAACAACTGCAGCACATGAAGTCCAACGAGTAAATGGAGAAGGCCAGAGAGTGACGTCAGACGTTACGCAATCATACAGCTGTGGGGCAGGGACTTCCGGGAGACTTGAAAGCTGCGACTCACGGGAGAACCAACATAGTGGTAACCGCCTCCCACATTTTGAATGACAGGAGCAAACAGCCAATAGCGTAGGCTGTCAACAAATGTTCAGAGGCGTCTTGGTCTCCATGGAGACCGCGGATTCCACCTCTCCCGGAAGGGATTGCTCAGTAGCCAATCGGAGGAGGAGATGGTACCAAGAGCGGATGTCCGGCTGTTGTGTGTTTGTCTGGCTGCCGGCACGTGAATCCGGATGTTGAAGGGAAGCGAGTAGAGAAATAAAAGAGGGGTATAAAGAGGTTTCGCTTCCGCACGATCATGTACGCCGTGTACCGACAAGCGCACCCGCCCACCGGCCTGGAGTTCTCCATGTCCTGCAACTTCTTCAACAACTCCGAGCGGAACCTGGTGGTGGCGGGAACCTCGCAGCTCTACGTGTATCGCCTCAACCCGAGCTCTGAGGTGAGTGTGAGAGACACAGAGAATCTCCTCACGGGAGCCTGTTGCTGTGGTTACAGCAGA
  5   1   1       add Kid  5g                         IMAGE:4032917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           GGACGCGTGGGTCGACCCACGCGTCCGGTCTGGCTGCCGGCACGTGAATCCGGATGTTGAAGGGAAGCGAGTAGAGAAATAAAAGAGAGGTATAAAGAGGTTTCGCTTCCGCACGATCATGTACGCCGTGTACCGACAAGCGCACCCGCCCACCGGCCTGGAGTTCTCCATGTCCTGCAACTTCTTCAACAACTCCGAGCGGAACCTGGTGGTGGCGGGAACCTCGCAGCTCTACGTGTATCGGCTCAACCCGAGCTCTGAGAGCTCGTCCAAAGGGGAGTCCGTGTCAGAGGTGAAGGGTCACAAGGAGAAGCTGGAGCTCATGGCCTCCTTCTCCTTCTTCGGTAACATCATGTCTATGGCCAGTGTCCAGTTGGCTGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTCAAGGAGGCCAAGCTCTCAGTCGTGGAGTACGACCCCGGGACCCATGATCTCAAGACTCTGTCCTTACATTACTTTGAGGAGCCAGAACTGCGGGACGGATTTGTGCAGAACGTTCACATCCCTAAAGTGCGTGTGGACCCCAGTGGGCGCTGCGCTGTCATGTTGATCTATGGCACCCAGCTGGTTGTTCTGCCCTTTCGGAGGGATACCCTGGCAGAGGAGCACGAAGGACTGGTGGGAGAAAGGCAGAAAGTCCAGTTTTCTTGCCCAGTTATATCATCCGACGTGAGGGGAACTTGGATGAGAAACCTGCTGAAATATCATTGAATATGCAAATTCCCTCATTGGGCTACTAATGGAGCCCACCCTTCCTTCATA
  5   1   1       add Ga18 5g                            xlk56h05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCNGATATCCGGCTGTTGTGTGTTTGTCTGGCTGCCGGCACGTGAATCCGGATGTTGAAGGGAAGCGAGTAGAGAAATAAAAGAGAGGTATAAAGAGGTTTCGCTTCCGCACGATCATGTACGCCGTGTACCGACAAGCGCACCCGCCCACCGGCCTGGAGTTCTCCATGTCCTGCAACTTCTTCAACAACTCCGAGCGGAACCTGGTGGTGGCGGGAACCTCGCAGCTCTACGTGTATCGGCTCAACCCGAGCTCTGAGANNNNNNCAAAGGGGAGTCCGTGTCAGAGGTGAAGGGTCACAAGGAGAAGCTGGAGCTCATGGCCTCCTTCTCCTTCTTCGGTAACATCATGTCTATGGCCAGTGTCCAGTTGGCTGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTCAAGGAGGCCAAGCTCTCAGTAGTGGAGTACGACCCCGGGACCCATGATCTCAAGACTCTGTCCTTACATTACTTTGAGGAGCCAGAACTGCGGGACGGATTTGTGCAGAACGTTCACATCCCTAAAGTGCGTGTGGNCCCCAGTGGGCGCTGNNNTGTCATGTTGATCTATGGCACCCAGCTGGTTGTTCTGCCCTTTCGGNGGGATANCCTGGCAGAGGAGCACGAGGGANTGGTGGGAGAAGGNNAGAAGTCCAGTTTCTTGCCCAGTTATATCATCGACGTGAGGNACTGGATGAGAAGCTGCTGAATATCATTNATA
  3   1   1       add Ooc1                              xlnoc003o14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTATGGGATCTCTCTGTCCAGACTGGAGCCAACCTAGGGNCTGTCCCTGCTGAGTTGTGCTTAGTGCAGGGAGTGCCTATGCTGCCATAGTTTTATGGGATCTCTCTGTACAGACTATGAGCAAACTTGNGGACTGTTCCTGCTGAATTGTGCTTAGTACAGGGAATACCTATGCTGCCATAGTTTTATGGGATCTCTCTGTACAGACTATGAGCAAACTTAGGGGCTGTTCCTGCTGAATTGTGCTTAGTACAGGGGAATTGTTTCTTTATTTAGTATTTGCATATGCTGAGAATTTTACAGAGCAGATCTGTGCACTGATGCTTTTCCCTGCATTATGTTGTGCTACTTTAAGGTACAACATGAGCTCAGTTGGGGGGGTATGTAGAAAAGGGGGGATGTGCCAGGTAAAGTATACATGTATTATGGATAGGGAACATGATGTGGGTGGCAGTGAGCAGGACTAACTGTCATGTTCTATAGGCAGAAGTCCAGTTTCTTGCCCAGTTATATCATCGACGTGAGGGAACTGGATGAGAAGCTGCTGAATATCATTGATATGCAATTCCTCCATGGCTACTATGAGCCCACCCTCCTAAAAAAAATAAAAGA
  5   1   1       add Neu7      out                        XL016b18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAAGTCCAGTTTCTTGCCCAGTTATATCATCGACGTGAGGGAACTGGATGAGAAGCTGCTGAATATCATTGATATGCAATTCCTCCATGGCTACTATGAGCCCACCCTCCTCATCCTGTTTGAGCCCAACCAGACCTGGCCTGGCCGAGTTGCCGTGCGACAGGACACCTGCAGCATTGTAGCGATTTCTCTGAACATTATGCAGAAAGTGCACCCCGTTATTTGGTCCCTCACCAGCCTCCCCTATGACTGCACCCAGGCACTGGCTGTACCCAAACCCATTGGTGGGGTGGTGATATTTGCTGTGAACTCCCTTCTGTACCTGAATCAGAGTGTCCCCCCATACGGTGTGTCGCTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGTTGCGCGTCACGCTCGATTGCTCCCAGGCCACGTTCATCTCCTATGACAAGATGGTGATTTCCCTGAATGGAGGAGAGATTTATGTTCTGACTCTCATCACAGACGGGATGCGCAGTGTCCGATCATTTCACTTTGACAAGGCGGCCGCCAGTGTCCTCACCACTTCTATGACCCCAATGGAGCCCGGCTATTTGTTTCTGGGCTCACGACTGGGCAACTCTCTCCTCCTGCGCTACACAGAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)