Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4173797.3                       6 END     1          20       16                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012796035 Xl3.1-IMAGE:4173797.5 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4173797.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCAAAGTTCCTGGGATGCCACCCCCATCAAACCATACCTTCTACCAGCTAAAGGATGGCAAAATCTACAGCAAATTGCAGAGACTCACCAAACTTGTAAGTGAAACCGACAGCGCCATTTATAGCTGTATGGTCACAGCATCCAGCATCACTAAAAATAGTGATCCCCTGAACATCCGTGTCTATGCCCCTGTTTCCAAACCAGTTCTGACCCATCGTAACCAGAGTATCAGCATGGCGGTGCAGGGCAGCACTATTGATCTCAGGTGCAAGTGTGACAAGGGAACTCTGCCTATAACCTATTCCTTACTGAAAGACTCAAAGGTTCTGCAAACCGCTACTGCAACACAGGACAAAGTAGCCGTGTTTCAACTCTTTATAAGTGAGCAGCAGAATTCTGGGCAATATCAGTGCAGAGCTTATAACTTGTATGATGGACCCGCTATGTACAGCAACATCGTCAGCATCACTGTCATACGTCCTATCAAGGAGGTCACACTAATGGCTGTCTCAGCCCAGTCGGGCATGGTGGAAGAAGGCAAAGACCTTTACCTGGAGTGTGCAGTTACAAGTGGGAGTTTGCCCATCGACTTCCACTTCTTTGTTAAAAAAGGAAAGGAAATTCTCTTCCACAACTCAACGGCTAATTTCTCATTCACCGTTTCTACACACATTGAGTCTTTCAGCGCCCATGATGATGGCAGCTACTTCTGTAGAGCCACCAACGGAGCCCATCAGACTGTGGACAGTGAGCATATATATGTAAAA
                                                  Xl3.1-CHK-1012704613                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTCCTGGGATGCCACCCCCATCAAACCATACCTTCTACCAGCTAAAGGATGGCAAAATCTACAGCAAATTGCAGAGACTCACCAAACTTGTAAGTGAAACCGACAGCGCCATTTATAGCTGTATGGTCACAGCATCCAGCATCACTAAAAATAGTGATCCCCTGAACATCCGTGTCTATGCCCCTGTTTCCAAACCAGTTCTGACCCATCGTAACCAGAGTATCAGCATGGCGGTGCAGGGCAGCACTATTGATCTCAGGTGCAAGTGTGACAAGGGAACTCTGCCTATAACCTATTCCTTACTGAAAGACTCAAAGGTTCTGCAAACCGCTACTGCAACACAGGACAAAGTAGCCGTGTTTCAACTCTTTATAAGTGAGCAGCAGAATTCTGGGCAATATCAGTGCAGAGCTTATAACTTGTATGATGGACCCGCTATGTACAGCAACATCGTCAGCATCACTGTCATACGTCCTATCAAGGAGGTCACACTAATGGCTGTCTCAGCCCAGTCGGGCATGGTGGAAGAAGGCAAAGACCTTTACCTGGAGTGTGCAGTTACAAGTGGGAGTTTGCCCATCGACTTCCACTTCTTTGTTAAAAAAGGAAAGGAAATTCTCTTCCACAACTCAACGGCTAATTTCTCATTCACCGTTTCTACACACATTGAGTCTTTCAGCGCCCATGATGATGGCAGCTACTTCTGTAGAGCCACCAACGGAGCCCATCAGACTGTGGACAGTGAGCATATATATGTAAAAGCTGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     2     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ag ---- 3e-007     XP_320312.4 AGAP012226-PA [Anopheles gambiae str. PEST] ---------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 8e-008     NP_001034052.1 CG14372-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-008     XP_001196485.1 PREDICTED: similar to SEC14 and spectrin domains 1 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- ?? ---- 8e-011     AAQ63873.1 FL1.6 [Xenopus sp. LG12] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 1e-014     XP_415669.2 PREDICTED: similar to C17orf60 protein [Gallus gallus] ----------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 6e-021     XP_697859.3 PREDICTED: hypothetical protein LOC569386 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 4e-029     XP_853419.1 PREDICTED: similar to platelet/endothelial cell adhesion molecule (CD31 antigen) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 2e-029     NP_776996.1 platelet/endothelial cell adhesion molecule (CD31 antigen) [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 9e-030     NP_001027550.1 platelet/endothelial cell adhesion molecule 1 isoform 2 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-032     NP_000433.3 platelet/endothelial cell adhesion molecule (CD31 antigen) [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 7e-145     NP_001089003.1 platelet endothelial cell adhesion molecule [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4173797.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   1       add FaB                             IMAGE:8072740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTATAGAGGAGGGAGATAAAATAGTGACGTTTCAGTGTAATGTTGAATTCATGATTATTCCAAAGTCAAAAGTCTCTGATTTCAGTGATGGGAAAATAGTTTCTGTGGAAGAACAGTTTTCAACTCCAAGGATTGAAGTTTTGCCATCAGTCAATTTTACTGAAGGGGAAAACATAACGGTTAAGTGCTCAATCCAGACATCATCCACTGTTTCTGGAAAGGTGGAACTTTTTATTCAGAAGGGCACATTTATTTTAAATAGCTCCACAACAGATACTGTATCATATGTCCAACTGGCTACAAATAACCATACTGGCCAATACATCTGCAAGGCAGAATATGAGCAGACATCCAAAGCCAACAGCGCCAACGTCATTGTGAAAGAGCTCTTTAAAACACCTCAGCTTGTTTCAAATGTTAAGAACTCCATTATCAATAAAGGTGCGATGTTGACTCTAAATTGCAAAGTTCCTGGGATGCCACCCCCATCAAACCATACCTTCTACCAGCTAAAGGATGGCAAAATCTACAGCAAATTGCAGAGACTCACCAAACTTGTAAGTGAAACCGACAGCGCCATTTATAGCTGTATGGTCACAGCATCCAGCATCACTAATAATAGTGATCCCCTGAACATCCGTGTCTAGGCCCCTGTTCCAAACCAGTTCTGACCATCGTAACCAGATTATCAGCATGGCGGTGCAGGCAGCACTATTGTCTCAGGGCAATGTGACAAGGAACTCGCCTC
  5   1   2       bld Tad2                            IMAGE:6933719.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGACTCTAAATTGCAAAGTTCCTGGGATGCCACCCCCATCAAACCATACCTTCTACCAGCTAAAGGATGGCAAAATCTACAGCAAATTGCAGAGACTCACCAAACTTGTAAGTGAAACCGACAGCGCCATTTATAGCTGTATGGTCACAGCATCCAGCATCACTAAAAATAGTGATCCCCTGAACATCCGTGTCTATGCCCCTGTTTCCAAACCAGTTCTGACCCATCGTAACCAGAGTATCAGCATGGCGGTGCAGGGCAGCACTATTGATCTCAGGTGCAAGTGTGACAAGGGAACTCTGCCTATAACCTATTCCTTACTGAAAGACTCAAAGGTTCTGCAAACCGCTACTGCAACACAGGACAAAGTAGCCGTGTTTCAACTCTTTATAAGTGAGCAGCAGAATTCTGGGCAATATCAGTGCAGAGCTTATAACTTGTATGATGGACCCGCTATGTACAGCAACATCGTCAGCATCACTGTCATACGTCCTATCAAGGAGGTCACACTAATGGCTGTCTCAGCCCAGTCGGGCATGGTGGAAGAANGCAAAGACCTTTACCTGGAGTGTGCAGTTACAAGTGGGAGTTTGCCCATCGACTTCCACTTCTTTGTTAAAAAAGGAAAAGAAATTCTCTTCCACAACTCAACGGGCTAATTCCTCATTTCACCGGTTTCTACACACATTGAAGTCTTTTCAACCGCCCCATGGATGAATGGGCAGCCTACCTTCTTGTAGAAAGCCACCCAAACCGGAAACCCCCA
  5   1   2      seed Sp1       out                   IMAGE:4173797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAGGATGGCAAAATCTACAGCAAATTGCAGAGACTCACCAAACTTGTAAGTGAAACCGACAGCGCCATTTATAGCTGTATGGTCACAGCATCCAGCATCACTAAAAATAGTGATCCCCTGAACATCCGTGTCTATGCCCCTGTTTCCAAACCAGTTCTGACCCATCGTAACCAGAGTATCAGCATGGCGGTGCAGGGCAGCACTATTGATCTCAGGTGCAAGTGTGACAAGGGAACTCTGCCTATAACCTATTCCTTACTGAAAGACTCAAAGGTTCTGCAAACCGCTACTGCAACACANGACAAAGCAGCCGTGTTTCAACTCTTTATAAGTGAGCAGCAGAATTCTGGGCAATATCAGTGCAGAGCTTATAACTTGTATGATGGACCCGCTATGTACAGCAACATCGTCAGCATCACTGTCATACGTCCTATCAAGGAGGTCACACTAATGGCTGTCTCAGCCCAGTCGGGCATGGTGGAAGAAGGCAAAGACCTTTACCTGGAGTGTGCAGTTACAAGTGGGAGTTTGCCCATCGACTTCCACTTCTTTGTTAAAAAAGGAAAGGAAATTCTCTTCCACAACTCAACGGCTAATTTCTCATTCACCGTTTCTACACACATTGAGTCTTTCAGCGCCCATGATGATGGCAGCTACTTCTGTAGAGCCACCAACGGAGCCCATCAGACTGTGGACAGTGAGCATATATATGTAAAAGCTGATCTCGCTACCTGGAAGAGGGGGCTCATTGCA
  5   1   1       add Lu1                             IMAGE:4058582.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGCGTCCGCAAACTTGTAAGTGAAACCGACAGCGCCATTTATAGCTGATGGCACAGCATCCAGCATCACTAAAAATAGTGATCCCCTGAACATCCGTGTCTATGCCCCTGTTTCCAAACCAGTTCTGACCCATCGTAACCAGAGTATCAGCATGGCGGTGCAGGGCAGCACTATTGATCTCAGGTGCAAGTGTGACAAGGGAACTCTGCCTATAACCTATTCCTTACTGAAAGAACTCAAGGGTCTGCCAACCGCTACTGCAACCACAGGACAAAGCAGCCGTGTTTCAACTCTTTATAAGTGAGCAGCAGAATTCTGGGCAATATCAGTGCAGAGCTTATAACTTGTATGATGGACCCGCTATGTACAGCAACATCGTCAGCATCACTGTCATACGTCCTATC
  5   1   2      skin Lu1                             IMAGE:4632845.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCTACACACATTGAGTCTTTCAGCGCCCATGATGATGGCAGCTACTTCTGTAGAGCCACCAACGGAGCCCATCAGACTGTGGACAGTGAGCATATATATGTAAAAGCTGTTCTCGCTACCTGGAAGAAGGGGCTCATTGTCACTTTTGTTGTGTTGATTCTTGTGGCTGCAATGGCCATTTGCTACTATTTCTGCATGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)