Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL090h15.3                            3 END     1          33       33                Unknown (protein for MGC:52547) [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6944839.5                       5 PI      90        365     1051                Unknown (protein for MGC:52547) [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012796170 Xl3.1-IMAGE:7211608.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7211608.5 CACCCACCCAGCCAGCACTTACCCCCTCCTGTGTGTCCTGCTCCTTTGGGCTCTAGGAGAATTGACTTGGAGTTTCTGCCCCTGTCCTGCGTCATTGCTCGCGTCACCGCTCCTTGGCCAGCTATTGGCATGGCGATGGGAGGGAGAAGCCTGCACTTATTATTAGCACAGGAGACAGTGTGTAAAAAAGCCAATAACGAAGACTGAATCCCTCCGGCGGCCAGTGCACAGCCATCTCTCCATCTCTTGTTTGTGTCTGTCGGGCAGCAGCTGAAAGCCCTGAATCCCTCCCAGCTGCAGCTGGGACTGGGAAGCAGCACCCTTGTATGAGCCGGACCTCCTGGGGTCCCGTCATCAATAAACCTGAGACGCTACCAGTGAATGAGCCCTGTTGTCTATCTTGTGCTTACTCGCCGGAGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTCTACCGACGCTTCGTCGTTGACTTCCACCGATTCCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGGTCCACTGGACCTGACAACCACCATGCGCCTCTGGAAAGGACCTGATTTAGCTCAGGTGTGCGGCGCTCTATGGATCCTAATGGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCAATTTAGTGGACAAGGGGATAGTTGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCGGAGAACATCACTGATATTTATATTGCAAACCAGCGATCATTGGCAAGTATTAATGATGATGACATAAAGATTTACACTGGACTGAGAAATCTAACTGTTGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGAAAGAACCTTAAACTTACATACATAAACTTCTCTAGAAATAAGTTAACATCTTTGACCAAGAAGATTTTTCGCAATCTGACCTTATCTCAGCTACTTCTTGGTGGCAATCCATTCCAGTGCTCGTGTGATTTAATGTGGGTTAAAGTATTACTGGAGACTAATTCCCTGAACATGGAGAACCAAAACATATACTGCTTCAATGACAACAAAAAGAAGATTCCTCTCTTCATATGCACATCCCCCACTGTGGGTTGCCTATAGTAAATGTGAGTACAGTAATATCACAGTTCTTTGAAGGTATGAGACAACCATGTACTGTGATGCCCATGGACTCCCGGACCCCAATTATCTCTGGGGGACACTCCCAAATCCTTTTTAAAAAGC
                                                  Xl3.1-CHK-1012711330       CCCAGCCAGCACTTACCCCCTCCTGTGTGTCCTGCTCCTTTGGGCTCTAGGAGAATTGACTTGGAGTTTCTGCCCCTGTCCTGCGTCATTGCTCGCGTCACCGCTCCTTGGCCAGCTATTGGCATGGCGATGGGAGGGAGAAGCCTGCACTTATTATTAGCACAGGAGACAGTGTGTAAAAAAGCCAATAACGAAGACTGAATCCCTCCGGCGGCCAGTGCACAGCCATCTCTCCATCTCTTGTTTGTGTCTGTCGGGCAGCAGCTGAAAGCCCTGAATCCCTCCCAGCTGCAGCTGGGACTGGGAAGCAGCACCCTTGTATGAGCCGGACCTCCTGGGGTCCCGTCATCAATAAACCTGAGACGCTACCAGTGAATGAGCCCTGTTGTCTATCTTGTGCTTACTCGCCGGAGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTCTACCGACGCTTCGTCGTTGACTTCCACCGATTCCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGGTCCACTGGACCTGACAACCACCATGCGCCTCTGGAAAGGACCTGATTTAGCTCAGGTGTGCGGCGCTCTATGGATCCTAATGGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCAATTTAGTGGACAAGGGGATAGTTGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCGGAGAACATCACTGATATTTATATTGCAAACCAGCGATCATTGGCAAGTATTAATGATGATGACATAAAGATTTACACTGGACTGAGAAATCTAACTGTTGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGAAAGAACCTTAAACTTACATACATAAACTTCTCTAGAAATAAGTTAACATCTTTGACCAAGAAGATTTTTCGCAATCTGACCTTATCTCAGCTACTTCTTGGTGGCAATCCATTCCAGTGCTCGTGTGATTTAATGTGGGTTAAAGTATTACTGGAGACTAATTCCCTGAACATGGAGAACCAAAACATATACTGCTTCAATGACAACAAAAAGAAGATTCCTCTCTTCATATGCACATCCCCCACTGTGGGTTGCCTATAGTAAATGTGAGTACAGTAATATCACAGTTCTTTGAAGGTATGAGACAACCATGTACTGTGATGCCCATGGACTCCCGGACCCCAATTATCTCTGGGGGACACTCCCAAATCCTTTTTAAAAAGCTTGGGT
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     588     317 
                                               BLH MIN     588      61 
                                               BLH MPR     333      61 
                                               BLH OVR     588     719 
                                               CDS MIN     588      61 
                                               ORF LNG     588      26 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 8e-007     NP_001097333.1 slit CG8355-PD, isoform D [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 5e-007     XP_001190187.1 PREDICTED: similar to toll-like receptor Tlr2.1 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ---- 6e-017     XP_613650.3 PREDICTED: neurotrophic tyrosine kinase, receptor, type 1 isoform 1 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Dr ---- 8e-033     XP_001919963.1 PREDICTED: si:ch211-220b11.1 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ---- 1e-052     NP_990562.1 tyrosine kinase receptor [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---= 5e-051     NP_001020245.1 neurotrophic tyrosine kinase, receptor, type 2 isoform a [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bt ---= 4e-051     NP_001068693.1 neurotrophic tyrosine kinase, receptor, type 2 [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---= 5e-053     NP_001018076.1 neurotrophic tyrosine kinase, receptor, type 2 isoform e precursor [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Cf ---= 3e-054     XP_848589.1 PREDICTED: similar to neurotrophic tyrosine kinase, receptor, type 2 isoform a precursor isoform 2 [Canis familiaris] ========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 2e-100     NP_001072653.1 neurotrophic tyrosine kinase, receptor, type 2 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 6e-112     NP_001090267.1 neurotrophic tyrosine kinase, receptor, type 2 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7211608.5                                                                                                                                  ATG---ATG------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------TGAATG------------------------------------TGA---ATG------------TAG------------ATG---------------------TGA---------------------------------------------------------------------------TAG---------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------TAGTAAATGTGA------TAA---------------------TGA---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2       bld Emb4 5g                         IMAGE:5515337.5p CACCCACCCAGCCAGCACTTACCCCCTCCTGTGTGTCCTGCTCCTTTGGGCTCTAGGAGAATTGACTTGGAGTTTCTGCCCCTGTCCTGCGTCATTGCTCGCGTCACCGCTCCTTGGCCAGCTATTGGCATGGCGATGGGAGGGAGAAGCCTGCACTTATTATTAGCACAGGAGACAGTGTGTAAAAAAGCCAATAACGAAGACTGAATCCCTCCGGCGGCCAGTGCACAGCCATCTCTCCATCTCTTGTTTGTGTCTGTCGGGCAGCAGCTGAAAGCCCTGAATCCCTCCCAGCTGCAGCTGGGACTGGGAAGCAGCACCCTTGTATGAGCCGGACCTCCTGGGGTCCCGTCATCAATAAACCTGAGACGCTACCAGTGAATGAGCCCTGTTGTCTATCTTGTGCTTACTCGCCGGAGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTCTACCGACGCTTCGTCGTTGACTTCCACCGATTCCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGGTCCACTGGACCTGACAACCACCATGCGCCTCTGGAAAGGACCTGATTTAGCTCAGGTGTGCGGCGCTCTATGGATCCTAATGGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCATTTNAGTGGNACAGGGGATAGTTGCTTTCCNNGTGCG
  5   1   2       bld Emb4      out                   IMAGE:4201757.5p                                                                                                                                                                                                                                                                  CACGCGTCCGGCTGAAAGCCCTGAATCCCTCCCAGAAGCTGCAGCTGGGACTGGGAAGCACACCCTTGTATGAGCCGGACCTCCTGGGGTCCCGTCATCAATAAACCTGAGACGCTACCAGTGAATGAGCCCTGTTGTCTATCTTGTGCTTACTCGCCGGAGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTCTACCGACGCTTCGTCGTTGACTTCCACCGATTCCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGGTCCACTGGACCTGACAACCACCATGCGCCTCTGGAAAGGACCTGATTTAGCTCAGGTGTGCGGCGCTCTATGGATCCTAATGGCCTTGGTTTGGAGGGGCCCTGGCTTGCCCCCCAGTACTTGGAGTTGTAACTCCACCAGG
  5   1   2      seed Te2  5x3                        IMAGE:7211608.5p                                                                                                                                                                                                                                                                                                                                                                                                                 TTGTGCTTACTCGCCGGAGCTGAGCTATGGTGTGTATCACTTAGCGCATTTGGATTATGACTCTACCGACGCTTCGTCGTTGACTTCCACCGATTCCCCCGGACCTATTGCTTTTCTGGATCAAACGCCTGGTGTTTAGGAGGATCCCCTCTCCATTCTAGGGGGGTCCACTGGACCTGACAACCACCATGCGCCTCTGGAAAGGACCTGATTTAGCTCAGGTGTGCGGCGCTCTATGGATCCTACTGGCCTTGGTTTGGAGGGGCCTGGCTTGCCCCCAGTACTGCAGCTGTAACTCCACCAGGATTTGGTGCAATTTAGTGGACAAGGGGATAGTTGCTTTCCCGGTGCTGGAGGACAGCTCACTGGCGGAGAACATCACTGATATTTATATTGCAAACCAGCGATCATTGGCAAGTATTAATGATGATGACATAAAGATTTACACTGGACTGAGAAATCTAACTGTTGTGGACTCAGGTTTACAGATTGTATCACGGCAAGCATTCCGAAAGAACCTTAAACTTACATACATAAACTTCTCTAGAAATAAGTTAACATCTTTGACCAAGAAGATTTTTCGCAATCTGACCTTATCTCAGCTACTTCTTGGTGGCAATCCATTCCAGTGCTCGTGTGATTTAATGTGGGTTAAAGTATTACTGGAGACTAATTCCCTGAACATGGAGAACCAAAACATATACTGCTTCAATGACAACAAAAAGAAGATTCCTCTCTTCATATGCACATCCCCCACTGTGGGTTGCCTATAGTAAATGTGAGTACAGTAATATCACAGTTCTTTGAAGGTATGAGACAACCATGTACTGTGATGCCCATGGACTCCCGGACCCCAATTATCTCTGGGGGACACTCCCAAATCCTTTTTAAAAAGCTTGGGTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)