Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-xl270a18.5                            6 END     2          66       33                bone morphogenetic protein 2 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl295c21.3                            2 PI      98        608      960                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012796280 Xl3.1-XL096l22.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL096l22.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGGGGAATGTCCTTTTCCACTGCGCAGACCATTTAACTTCTACAAACCATGCAATTGGTACAAACTTTGGTGAATTCCAGTCAAACACAAACATCATTCCCAAAGCTGCTTGCGTCCCCACAGAACTCAGTGCCATCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCAAGACATGGTCGTGGAGGGGTGCGGGTGCCGTTAGGCGGGGACACACAAGCCAGAGACAAGAAAGCTGACACTTTAATATTTCCTTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAAATAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGTGTTTTTTTCTTCTTTTTTTTAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAGTTATAAACTTGATGATGTGTTGGTTCATTGGTAAATCCTCCATATTGTGCAATTAACATGCATTTTTATAATGTACGAAGTCCAGTCCATTGTGCATTGCTTTGCAATTTAGAATTGGAATTCATACATGTAATAATTGCCGAAAACAACTACTGCCATTTTCAAATTTTTTTTTTTGAGAATTCATTTGGGCCAGTTGAATTTTTTTTCCTCATAAGAATTTAAAAAAAGAAATAAAGCTTGGCTGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAATTGTTCTTAAATTTGACAAATT------------------------GGGATTATATAC
                                                  Xl3.1-CHK-1012712286                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGTCCTTTTCCACTGCGCAGACCATTTAACTTCTACAAACCATGCAATTGGTACAAACTTTGGTGAATTCCAGTCAAACACAAACATxxxxCxCAAAGCTxxxTGCGTCCCCACAGAACTCAGTGCCATCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCAAGACATGGTCGTGGAGGGGTGCGGGTGCCGTTAGGCGGGGACACACAAGCCAGAGACAAGAAAGCTGACACTTTAATATTTCCTTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAAATAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGTGTTTTTTTCTTCTTTTTTTTAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAGTTATAAACTTGATGATGTGTTGGTTCATTGGTAAATCCTCCATATTGTGCAATTAACATGCATTTTTATAATGTACGAAGTCCAGTCCATTGTGCATTGxTTxxxAATTTAGAATTGGAATTCATACATGTAATAATTGCCGAAAACAACTACTGCCATTTTCAAATTTTTTTTTTTGAGAATTCATTTGGGCCAGTTGAATTTTTTTTCCTCATAAGAATTTAAAAAAAGAAATAAAGCTTGGCTGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAATTGTTCTTAAATTTGACAAATTTAAATA------------GCTTCTGGGATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     3     1     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     0     1     1     1
                                                                                                                                                                                                 PROTEIN --- Ce ---- 2e-008     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 3e-012     NP_001072008.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 6e-012     XP_874937.3 PREDICTED: similar to bone morphogenetic protein 6 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-015     NP_722813.1 decapentaplegic CG9885-PE [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                                                                       PROTEIN --- Ag ---- 5e-018     XP_317480.2 AGAP007987-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 5e-020     NP_001116977.1 bone morphogenetic protein BMP2/4 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                     PROTEIN --- Dr ---- 4e-020     NP_571417.1 bone morphogenetic protein 4 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                           PROTEIN --- Xt ---- 4e-021     AAT72007.1 BMP-2 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                    PREDICTED - Cf ---- 2e-021     XP_534351.2 PREDICTED: similar to Bone morphogenetic protein 2 precursor (BMP-2) (BMP-2A) isoform 1 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                    PROTEIN --- Bt ---- 1e-021     NP_001092611.1 bone morphogenetic protein 2 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                       PROTEIN --- Mm ---- 1e-021     NP_031579.2 bone morphogenetic protein 2 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                 PROTEIN --- Hs ---- 1e-021     NP_001191.1 bone morphogenetic protein 2 precursor [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                             PROTEIN --- Gg ---- 8e-022     NP_989689.1 bone morphogenetic protein 2 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                           PROTEIN --- Xl ---- 8e-022     NP_001095136.1 bone morphogenetic protein 2 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                      Xl3.1-XL096l22.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG------------------------------------------------ATG------------------------TAG---------------------------------------TAA------------------------ATG---TGA---ATGATG------------TGA------------------------------------------TAA---------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------ATG------------------------------TAA---ATG------------------------------------------------------------------------------------------------TAA------------------------------------ATG------------------------------------TAG---------------ATGTAATAA------------------------------------------------------------------------------TAA------------------------------------------------------------------TAA
  3   1   1       add Egg3      out                   IMAGE:3379217.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGGGGAATGTCCTTTTCCACTGCGCAGACCATTTAACTTCTACAAACCATGCAATTGGTACAAACTTTGGTGAATTCCAGTCAAACACAAACATTTCCCAANAGCTTGCTTGCGTCCCCACAGAACTCAGTGCCATCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCAAGACATGGTCGTGGAGGGGTGCGGGTGCCGTTAGGCGGGGACACACAAGCCAGAGACAAGAAAGCTGACACTTTAATATTTCCTTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAATTAAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGCAGATTCAATGTGTTTTTTTCTTCTTCTCTTTTTTTAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAATTAT
  3   1   2       bld Ga18      out                     xlk117b02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GNAATCGTNNAANNTTTGGTGANTNNNNNCAACANAAANATTCCCAAANCNTNGCTNNNNNNCCACAGAACTNAGNNNNTCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCCAAGACATGGTCGTGGAGGGGTGCGGGTNNCGTTAGGCGGGGACACACAANCCAGAGACAAGAAAGCTGACACTTTAATATTTCCTTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAAATAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGTGTTTTTTTCTTCTTTTTTTTAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAGTTATAAACTTGATGATGTGTTGGTTCATTGGTAAATCCTCCATATTGTGCAATTAACATGCATTTTTATAATGTACGAAGTCCAGTCCATTGTGCANNCTTTGCAAATTTAGAATTGGAATTCATACATGTAATAATTGCCGAAAACAACTACTGCCATTTTCAAATTTTTTTTTTTGAGAATTCATTTGGGCCAGTTGAATTTTTTTTCCTCATAAGAATTTAAAAAAAGAAATAAAGCTTGGCTGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAATTGTTCTTAAATTTGACAAATTTAAATATCANNNNNAAGTGCTTCTGGGATTATATACANNAATAGCTCTGNNNNNCTTAAAAA
  5   1   2      seed Tbd7                                 XL096l22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGAATTCCGTCAACACAAACATTCCCAAAGCTTGCTGCGTCCCCACAGAACTCAGTGCCATCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCAAGACATGGTCGTGGAGGGGTGCGGGTGCCGTTAGGCGGGGACACACAAGCCAGAGACAAGAAAGCTGACACTTTAATATTTCCCTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAAATAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGTGtttttttcttcttttttttAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAGTTATAAACTTGATGATGTGTTGGTTCATTGGTAAATCCTCCATATTGTGCAATTAACATGCATTTTTATAATGTACGAAGTCCAGTCCATTGTGCATTGCTTTGCAAATTTAGAATTGGAATTCATACATGTAATAATTGCCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)