Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 06 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-xl270a18.5                            6 END     2          66       33                bone morphogenetic protein 2 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl295c21.3                            2 PI      98        608      960                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012796280 Xl3.1-XL096l22.5 - 3 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL096l22.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGGGGAATGTCCTTTTCCACTGCGCAGACCATTTAACTTCTACAAACCATGCAATTGGTACAAACTTTGGTGAATTCCAGTCAAACACAAACATCATTCCCAAAGCTGCTTGCGTCCCCACAGAACTCAGTGCCATCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCAAGACATGGTCGTGGAGGGGTGCGGGTGCCGTTAGGCGGGGACACACAAGCCAGAGACAAGAAAGCTGACACTTTAATATTTCCTTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAAATAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGTGTTTTTTTCTTCTTTTTTTTAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAGTTATAAACTTGATGATGTGTTGGTTCATTGGTAAATCCTCCATATTGTGCAATTAACATGCATTTTTATAATGTACGAAGTCCAGTCCATTGTGCATTGCTTTGCAATTTAGAATTGGAATTCATACATGTAATAATTGCCGAAAACAACTACTGCCATTTTCAAATTTTTTTTTTTGAGAATTCATTTGGGCCAGTTGAATTTTTTTTCCTCATAAGAATTTAAAAAAAGAAATAAAGCTTGGCTGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAATTGTTCTTAAATTTGACAAATT------------------------GGGATTATATAC
                                                  Xl3.1-CHK-1012712286                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGTCCTTTTCCACTGCGCAGACCATTTAACTTCTACAAACCATGCAATTGGTACAAACTTTGGTGAATTCCAGTCAAACACAAACATxxxxCxCAAAGCTxxxTGCGTCCCCACAGAACTCAGTGCCATCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCAAGACATGGTCGTGGAGGGGTGCGGGTGCCGTTAGGCGGGGACACACAAGCCAGAGACAAGAAAGCTGACACTTTAATATTTCCTTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAAATAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGTGTTTTTTTCTTCTTTTTTTTAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAGTTATAAACTTGATGATGTGTTGGTTCATTGGTAAATCCTCCATATTGTGCAATTAACATGCATTTTTATAATGTACGAAGTCCAGTCCATTGTGCATTGxTTxxxAATTTAGAATTGGAATTCATACATGTAATAATTGCCGAAAACAACTACTGCCATTTTCAAATTTTTTTTTTTGAGAATTCATTTGGGCCAGTTGAATTTTTTTTCCTCATAAGAATTTAAAAAAAGAAATAAAGCTTGGCTGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAATTGTTCTTAAATTTGACAAATTTAAATA------------GCTTCTGGGATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     3     1     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     0     1     1     1
                                                                                                                                                                                                 PROTEIN --- Ce ---- 2e-008     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 3e-012     NP_001072008.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 6e-012     XP_874937.3 PREDICTED: similar to bone morphogenetic protein 6 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-015     NP_722813.1 decapentaplegic CG9885-PE [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                                                                       PROTEIN --- Ag ---- 5e-018     XP_317480.2 AGAP007987-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 5e-020     NP_001116977.1 bone morphogenetic protein BMP2/4 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                     PROTEIN --- Dr ---- 4e-020     NP_571417.1 bone morphogenetic protein 4 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                           PROTEIN --- Xt ---- 4e-021     AAT72007.1 BMP-2 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                    PREDICTED - Cf ---- 2e-021     XP_534351.2 PREDICTED: similar to Bone morphogenetic protein 2 precursor (BMP-2) (BMP-2A) isoform 1 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                    PROTEIN --- Bt ---- 1e-021     NP_001092611.1 bone morphogenetic protein 2 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                       PROTEIN --- Mm ---- 1e-021     NP_031579.2 bone morphogenetic protein 2 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                 PROTEIN --- Hs ---- 1e-021     NP_001191.1 bone morphogenetic protein 2 precursor [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                                             PROTEIN --- Gg ---- 8e-022     NP_989689.1 bone morphogenetic protein 2 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                                                           PROTEIN --- Xl ---- 8e-022     NP_001095136.1 bone morphogenetic protein 2 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================
                                                      Xl3.1-XL096l22.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG------------------------------------------------ATG------------------------TAG---------------------------------------TAA------------------------ATG---TGA---ATGATG------------TGA------------------------------------------TAA---------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------ATG------------------------------TAA---ATG------------------------------------------------------------------------------------------------TAA------------------------------------ATG------------------------------------TAG---------------ATGTAATAA------------------------------------------------------------------------------TAA------------------------------------------------------------------TAA
  3   1   1       add Egg3      out                   IMAGE:3379217.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGGGGAATGTCCTTTTCCACTGCGCAGACCATTTAACTTCTACAAACCATGCAATTGGTACAAACTTTGGTGAATTCCAGTCAAACACAAACATTTCCCAANAGCTTGCTTGCGTCCCCACAGAACTCAGTGCCATCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCAAGACATGGTCGTGGAGGGGTGCGGGTGCCGTTAGGCGGGGACACACAAGCCAGAGACAAGAAAGCTGACACTTTAATATTTCCTTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAATTAAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGCAGATTCAATGTGTTTTTTTCTTCTTCTCTTTTTTTAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAATTAT
  3   1   2       bld Ga18      out                     xlk117b02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GNAATCGTNNAANNTTTGGTGANTNNNNNCAACANAAANATTCCCAAANCNTNGCTNNNNNNCCACAGAACTNAGNNNNTCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCCAAGACATGGTCGTGGAGGGGTGCGGGTNNCGTTAGGCGGGGACACACAANCCAGAGACAAGAAAGCTGACACTTTAATATTTCCTTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAAATAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGTGTTTTTTTCTTCTTTTTTTTAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAGTTATAAACTTGATGATGTGTTGGTTCATTGGTAAATCCTCCATATTGTGCAATTAACATGCATTTTTATAATGTACGAAGTCCAGTCCATTGTGCANNCTTTGCAAATTTAGAATTGGAATTCATACATGTAATAATTGCCGAAAACAACTACTGCCATTTTCAAATTTTTTTTTTTGAGAATTCATTTGGGCCAGTTGAATTTTTTTTCCTCATAAGAATTTAAAAAAAGAAATAAAGCTTGGCTGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAATTGTTCTTAAATTTGACAAATTTAAATATCANNNNNAAGTGCTTCTGGGATTATATACANNAATAGCTCTGNNNNNCTTAAAAA
  5   1   2      seed Tbd7                                 XL096l22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGAATTCCGTCAACACAAACATTCCCAAAGCTTGCTGCGTCCCCACAGAACTCAGTGCCATCTCCATGCTCTATCTTGATGAGAATGAAAAAGTAGTATTAAAGAATTATCAAGACATGGTCGTGGAGGGGTGCGGGTGCCGTTAGGCGGGGACACACAAGCCAGAGACAAGAAAGCTGACACTTTAATATTTCCCTTTGGAGACTATATTTATGCTTTGAAAAATGATGAAACAATTATTTTGAAAATATATTTATGTCTACACGGAGGCTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTAGTTGTACATTTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTAAGGAAAAAAATAGCTGTTTTGTATTTATATGTAATCAACAGAGAAAATATAGGGTTTGTAAATATGTTACTGAAAGTGtttttttcttcttttttttAAATTATGTATACACAGCTGGTTATATGGCAAGTTTTTTATATTTTCTATAAAGCTAATTTCAAGGTCATTAGTTATAAACTTGATGATGTGTTGGTTCATTGGTAAATCCTCCATATTGTGCAATTAACATGCATTTTTATAATGTACGAAGTCCAGTCCATTGTGCATTGCTTTGCAAATTTAGAATTGGAATTCATACATGTAATAATTGCCG

In case of problems mail me! (