Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL014n21.3                            2 END     1          50       50                (no blast hit)

 This cluster: approximate FL confidence score = 89%

 1012796429 Xl3.1-XL014n21.5 - 2 ESTs
                                                                       .....-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL014n21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACAGGAGCTCATTCCCGATGCTCAAGTGAAGATCAGAGTTTCTCCGAAGAGGGACCAGACTGGCTGGGGCTGAATTCCCATCTGCTCTGCAAGGGAGGGGGTCCTGCTTTCTGGACAAGAGGCTTCATCTTCTGAAAGTGGCAACTTATAGGAACTATAAGATTTCCCCTGTTTACAAGTGAAGATGCCTCGTCCTGGAAGAAACACCTACAGCGACCAGAAGCCTCCTTATTCCTACATTTCCCTGACCGCCATGGCCATCCAAGGCTCCCAAGAGAAGATGCTGCCCCTCAGTGAGATCTACAAGTTTATCATGGACAGGTTCCCCTACTACAGAGAAAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCTGATCAGCCTGGAAAGGGCAGTTTCTGGGCGCTGCATCCCAGGTGTGGGGATATGTTCGAAAATGGCAGTTTCTTAAGGCGCAGGAAGAGGTTCAAGGTGATGAAATCGGACCACCTGGCCCCCAGCAAAGCCTCGGATGCCGCCCAATACCTGCAGCAACAAGCCAAGTTAAGACTGAGCGCCCTAGCGGCCTCTGGTACTCACTTGCCCCCGATGTCCACCTACAATCTAGGGGTATCTCCGACTTCCAGCTTTAAGCACCCCTTTGCCATTGAGAATATTATCGCCAGAGAGTATAAAATGCCAGGAGGA
                                                  Xl3.1-CHK-1012715606                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCTCATTCCCGATGCTCAAGTGAAGATCAGAGTTTCTCCGAAGAGGGACCAGACTGGCTGGGGCTGAATTCCCATCTGCTCTGCAAGGGAGGGGGTCCTGCTTTCTGGACAAGAGGCTTCATCTTCTGAAAGTGGCAACTTATAGGAACTATAAGATTTCCCCTGTTTACAAGTGAAGATGCCTCGTCCTGGAAGAAACACCTACAGCGACCAGAAGCCTCCTTATTCCTACATTTCCCTGACCGCCATGGCCATCCAAGGCTCCCAAGAGAAGATGCTGCCCCTCAGTGAGATCTACAAGTTTATCATGGACAGGTTCCCCTACTACAGAGAAAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCTGATCAGCCTGGAAAGGGCAGTTTCTGGGCGCTGCATCCCAGGTGTGGGGATATGTTCGAAAATGGCAGTTTCTTAAGGCGCAGGAAGAGGTTCAAGGTGATGAAATCGGACCACCTGGCCCCCAGCAAAGCCTCGGATGCCGCCCAATACCTGCAGCAACAAGCCAAGTTAAGACTGAGCGCCCTAGCGGCCTCTGGTACTCACTTGCCCCCGATGTCCACCTACAATCTAGGGGTATCTCCGACTTCCAGCTTTAAGCACCCCTTTGCCATTGAGAATATTATCGCCAGAGAGTATAAAATGCCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     186     197                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN     183     115                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR     186     259                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG     186       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Gg ---- 2e-043     XP_001236383.1 PREDICTED: forkhead box A2 [Gallus gallus] ----------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Ce ==== 1e-050     NP_494704.1 abnormal cell LINeage LIN-31, forkhead box B1.1 (26.9 kD) (lin-31)[Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Ag ==== 2e-051     XP_312480.3 AGAP002460-PA [Anopheles gambiae str. PEST] ==================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Ci ==== 4e-054     NP_001122339.1 transcription factor protein [Ciona intestinalis] ==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dm ==== 1e-053     NP_524495.1 forkhead domain 96Ca CG11921-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 7e-061     XP_870057.3 PREDICTED: similar to forkhead box B2 [Bos taurus] ==============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Sp ==== 2e-062     NP_999797.1 winged helix transcription factor Forkhead-1 [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 2e-093     NP_571360.1 forkhead box B1.2; mariposa; fork head domain protein 3; forkhead-3 [Daniorerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 2e-095     NP_071773.2 forkhead box B1 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 2e-095     NP_036314.2 forkhead box B1 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Bt ==== 1e-095     XP_585450.1 PREDICTED: similar to winged-helix protein [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 6e-096     XP_544707.2 PREDICTED: similar to Forkhead box protein B1 (Transcription factor FKH-5) [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 2e-102     NP_001107970.1 forkhead box B1 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 1e-105     NP_001081836.1 forkhead-domain-containing protein 5 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL014n21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA---------------------------------------------------------------------------TAG------TAA------------------------ATG------------------------------------------------------------------ATG------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2      seed Neu7 5g3  out                        XL014n21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACAGGAGCTCATTCCCGATGCTCAAGTGAAGATCAGAGTTTCTCCGAAGAGGGACCAGACTGGCTGGGGCTGAATTCCCATCTGCTCTGCAAGGGAGGGGGTCCTGCTTTCTGGACAAGAGGCTTCATCTTCTGAAAGTGGCAACTTATAGGAACTATAAGATTTCCCCTGTTTACAAGTGAAGATGCCTCGTCCTGGAAGAAACACCTACAGCGACCAGAAGCCTCCTTATTCCTACATTTCCCTGACCGCCATGGCCATCCAAGGCTCCCAAGAGAAGATGCTGCCCCTCAGTGAGATCTACAAGTTTATCATGGACAGGTTCCCCTACTACAGAGAAAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCTGATCAGCCTGGAAAGGGCAGTTTCTGGGCGCTGCATCCCAGGTGTGGGGATATGTTCGAAAATGGCAGTTTCTTAA
  5   1   2       bld Em10 5g                         IMAGE:8318684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGTGAAGATCAGAGTTTCTCCGAAGAGGGACCAGACTGGCTGGGGCTGAATTCCCATCTGCTCTGCAAGGGAGGGGGTCCTGCTTTCTGGACAAGAGGCTTCATCTTCTGAAAGTGGCAACTTATAGGAACTATAAGATTTCCCCTGTTTACAAGTGAAGATGCCTCGTCCTGGAAGAAACACCTACAGCGACCAGAAGCCTCCTTATTCCTACATTTCCCTGACCGCCATGGCCATCCAAGGCTCCCAAGAGAAGATGCTGCCCCTCAGTGAGATCTACAAGTTTATCATGGACAGGTTCCCCTACTACAGAGAAAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCTGATCAGCCTGGAAAGGGCAGTTTCTGGGCGCTGCATCCCAGGTGTGGGGATATGTTCGAAAATGGCAGTTTCTTAAGGCGCAGGAAGAGGTTCAAGGTGATGAAATCGGACCACCTGGCCCCCAGCAAAGCCTCGGATGCCGCCCAATACCTGCAGCAACAAGCCAAGTTAAGACTGAGCGCCCTAGCGGCCTCTGGTACTCACTTGCCCCCGATGTCCACCTACAATCTAGGGGTATCTCCGACTTCCAGCTTTAAGCACCCCTTTGCCATTGAGAATATTATCGCCAGAGAGTATAAAATGCCAGGAGGACTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)