Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6934467.5                       5 PI      74        796     1211                Retinoic acid receptor RXR-gamma (Retinoid X receptor gamma) (Nuclear receptor subfamily 2 group B member 3)

 This cluster: approximate FL confidence score = 0%

 1012796523 Xl3.1-XL162m21.5 - 3 ESTs
                                                                       .........-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL162m21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCCCCCATCAATGGAATGGGCCCACCTTTCTCTGTTATCAGCCCTCCGCTGGGCCCATCAATGGCCATTCCTTCGACTCCCGGCCTCGGCTATGGAACAGGCAGCCCTCAGATCCATTCCCCCATGAACTCGGTCAGCAGCACAGAAGACATCAAGCCTCCTCCGGGAATCAACGGCATCCTTAAAGTACCCATGCATCCCTCCGGAGCTATGGCCTCTTTCACTAAGCACATCTGCGCCATCTGTGGTGACAGATCTTCAGGCAACATTACGGGGTTTACAGCTGCGAGGGCTGCAAGGGGTTTTTCAAGCGGACGGTGCGGAAGGACCTGACTTACACGTGCAGGGATAGCAAAGACTGTATGATCGACAAACGCCAGAGGAACCGGTGCCAGTACTGCCGGTACCAGAAATGCCTGGCCATGGGCATGAAACGAGAAGCAGTACAGGAGGAGAGACAGAGGGGGAAGGAACGAAATGAGAATGAAGTAGAGAGTAGCAACAGTGCCAACGAGGACATGCCGGTGGAGAAGATCCTTGAGGCGGAGCACGCGGTGGAACCAAAGACAGAGACGTACACTGAGGCTAACATGGGCCTTGCTCCCAACTCCCCCAGCGACCCCGTTACCAACATTTGCCAAGCAGCAGACAAGCAGCTCTTCACACTGGTCGAATGGGCAAAGAGAATCCCGCATTTCTCTGAGCTGCCGCTGGATGACCAAGTTATCCTCCTTAGGGCAGGGTGGAATGAGCTCCTCATAGCCTCTTTTTCCCATCGGTCGATAGCCGTCAAAGATGGAATCCTTCTGGCCACAGGACTTCACGTACATCGGAACAGCGCTCACAGTGCAGGAGTCGGTGCAATTTTTGATAGGGTCCTCACTGAGCTGGTGTCCAAAATGCGAGACATGCAGATGGACAAAACAGAACTCGGTTGCTTACGAGCAATTGTCCTCTTCAACCCAGACTCAAAAGGTCTCTCGAACCCTTTGGAGGTTGAGGCTCTCCGAGAGAAGGTCTATGCATCGTTAGAAGCCTACTGCAAACAGAAATACCCCGAACAGCCCGGGAGATTTGCTAAACTTCTCCTACGCCTGCCAGCTCTACGATCTATTGGCCTCAAATGTCTGGAACACCTCTTCTTCTTCAAACTAATAAGAGACACACCAATCGACACTTTCTTAATGGAGATGCTGGAAGCCCCTCACCAAATGACTTAAGAAAAATGGAGATCTTTCGTTTGTGCGTTGAGGGCTATGGACTCCTTGTTGGACGCCCTCAGGGACACTTTGGTCTCCAGGACACCTACAGCGGGAAAA
                                                  Xl3.1-CHK-1012713706                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCAATGGAATGGGCCCACCTTTCTCTGTTATCAGCCCTCCGCTGGGCCCATCAATGGCCATTCCTTCGACTCCCGGCCTCGGCTATGGAACAGGCAGCCCTCAGATCCATTCCCCCATGAACTCGGTCAGCAGCACAGAAGACATCAAGCCTCCTCCGGGAATCAACGGCATCCTTAAAGTACCCATGCATCCCTCCGGAGCTATGGCCTCTTTCACTAAGCACATCTGCGCCATCTGTGGTGACAGATCTTCAGGCAACATTACGGGGTTTACAGCTGCGAGGGCTGCAAGGGGTTTTTCAAGCGGACGGTGCGGAAGGACCTGACTTACACGTGCAGGGATAGCAAAGACTGTATGATCGACAAACGCCAGAGGAACCGGTGCCAGTACTGCCGGTACCAGAAATGCCTGGCCATGGGCATGAAACGAGAAGCAGTACAGGAGGAGAGACAGAGGGGGAAGGAACGAAATGAGAATGAAGTAGAGAGTAGCAACAGTGCCAACGAGGACATGCCGGTGGAGAAGATCCTTGAGGCGGAGCACGCGGTGGAACCAAAGACAGAGACGTACACTGAGGCTAACATGGGCCTTGCTCCCAACTCCCCCAGCGACCCCGTTACCAACATTTGCCAAGCAGCAGACAAGCAGCTCTTCACACTGGTCGAATGGGCAAAGAGAATCCCGCATTTCTCTGAGCTGCCGCTGGATGACCAAGTTATCCTCCTTAGGGCAGGGTGGAATGAGCTCCTCATAGCCTCTTTTTCCCATCGGTCGATAGCCGTCAAAGATGGAATCCTTCTGGCCACAGGACTTCACGTACATCGGAACAGCGCTCACAGTGCAGGAGTCGGTGCAATTTTTGATAGGGTCCTCACTGAGCTGGTGTCCAAAATGCGAGACATGCAGATGGACAAAACAGAACTCGGTTGCTTACGAGCAATTGTCCTCTTCAACCCAGACTCAAAAGGTCTCTCGAACCCTTTGGAGGTTGAGGCTCTCCGAGAGAAGGTCTATGCATCGTTAGAAGCCTACTGCAAACAGAAATACCCCGAACAGCCCGGGAGATTTGCTAAACTTCTCCTACGCCTGCCAGCTCTACGATCTATTGGCCTCAAATGTCTGGAACACCTCTTCTTCTTCAAACTAATAAGAGACACACCAATCGACACTTTCTTAATGGAGATGCTGGAAGCCCCTCACCAAATGACTTAAGAAAAATGGAGATCTTTCGTTTGTGCGTTGAGGGCTATGGACTCCTTGTTGGACGCCCTCAGGGACACTTTGGTCTCCAGGACACCTACAGCGGGAAAAAAAAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     264     223                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 9e-044     NP_001021042.2 Nuclear Hormone Receptor family member (nhr-64) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 7e-091     NP_476781.1 CG4380-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ag ---- 2e-094     XP_320944.4 AGAP002095-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 6e-132     NP_001071809.1 nuclear receptor [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 8e-146     XP_784246.2 PREDICTED: similar to retinoic X receptor-like protein, partial [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Gg ---- 4e-157     NP_990625.1 retinoic acid receptor [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bt ---- 2e-157     NP_001068876.1 retinoid X receptor, gamma [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xt ---- 1e-158     AAI67577.1 Rxrb protein [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Dr ---- 5e-174     XP_001923873.1 PREDICTED: RXRalpha-B [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Cf ---- 5e-174     XP_858806.1 PREDICTED: similar to Retinoic acid receptor RXR-alpha (Retinoid X receptor alpha) isoform 11 [Canis familiaris] ---------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - ?? ---- 4e-175     XP_887036.3 PREDICTED: retinoid X receptor, alpha isoform 4 [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Mm ---- 4e-177     XP_001477381.1 PREDICTED: similar to retinoid X receptor-alpha [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 2e-177     NP_002948.1 retinoid X receptor, alpha [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xl ---- 0          P51128 Retinoic acid receptor RXR-alpha (Retinoid X receptor alpha) [Xenopus laevis]  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL162m21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAA---------------------------------------TAA---------------------TGA---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------ATG---TAA------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld Kid                             IMAGE:7008644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCCCCCATCAATGGAATGGGCCCACCTTTCTCTGTTATCAGCCCTCCGCTGGGCCCATCAATGGCCATTCCTTCGACTCCCGGCCTCGGCTATGGAACAGGCAGCCCTCAGATCCATTCCCCCATGAACTCGGTCAGCAGCACAGAAGACATCAAGCCTCCTCCGGGAATCAACGGCATCCTTAAAGTACCCATGCATCCCTCCGGAGCTATGGCCTCTTTCACTAAGCACATCTGCGCCATCTGTGGTGACAGATCTTCAGGCAACATTACGGGGTTTACAGCTGCGAGGGCTGCAAGGGGTTTTTCAAGCGGACGGTGCGGAAGGACCTGACTTACACGTGCAGGGATAGCAAAGACTGTATGATCGACAAACGCCAGAGGAACCGGTGCCAGTACTGCCGGTACCAGAAATGCCTGGCCATGGGCATGAAACGAGAAGCAGTACAGGAGGAGAGACAGAGGGGGAAGGAACGAAATGAGAATGAAGTAGAGAGTAGCAACAGTGCCAACGAGGACATGCCGGTGGAGAAGATCCTTGAGGCGGAGCACGCGGTGGAACCAAAGACAGAGACGTACACTGAGGCTAACATGGGCCTTGCTCCCAACTCCCCCAGCGACCCCGTTACCAACATTTGCCAAGCAGCAGACAAGCAGCTCTTCACACTGGTCGAATGGGCAAAGAGAATCCCGCATTTCTCTGAGCTGCCGCTGGATGACCNAGTATCCTCCTANGGCA
  5   1   2      seed Ga12      in                         XL162m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTACACGTGCAGGGATAGCAAAGACTGTATGATCGACAAACGCCAGAGGAACCGGTGCCAGTACTGCCGGTACCAGAAATGCCTGGCCATGGGCATGAAACGAGAAGCAGTACAGGAGGAGAGACAGAGGGGGAAGGAACGAAATGAGAATGAAGTAGAGAGTAGCAACAGTGCCAACGAGGACATGCCGGTGGAGAAGATCCTTGAGGCGGAGCACGCGGTGGAACCAAAGACAGAGACGTACACTGAGGCTAACATGGGCCTTGCTCCCAACTCCCCCAGCGACCCCGTTACCAACATTTGCCAAGCAGCAGACAAGCAGCTCTTCACACTGGTCGAATGGGCAAAGAGAATCCCGCATTTCTCTGAGCTGCCGCTGGATGACCAAGTTATCCTCCTTAGGGCAGGGTGGAATGAGCTCCTCATAGCCTCTTTTTCCCATCGGTCGATAGCCGTCAAAGATGGAAT
  3   1   2       bld Ga12      in                         XL162m21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTTGCTCCCAACTCCCCCAGCGACCCCGTTACCAACATTTGCCAAGCAGCAGACAAGCAGCTCTTCACACTGGTCGAATGGGCAAAGAGAATCCCGCATTTCTCTGAGCTGCCGCTGGATGACCAAGTTATCCTCCTTAGGGCAGGGTGGAATGAGCTCCTCATAGCCTCTTTTTCCCATCGGTCGATAGCCGTCAAAGATGGAATCCTTCTGGCCACAGGACTTCACGTACATCGGAACAGCGCTCACAGTGCAGGAGTCGGTGCAATTTTTGATAGGGTCCTCACTGAGCTGGTGTCCAAAATGCGAGACATGCAGATGGACAAAACAGAACTCGGTTGCTTACGAGCAATTGTCCTCTTCAACCCAGACTCAAAAGGTCTCTCGAACCCTTTGGAGGTTGAGGCTCTCCGAGAGAAGGTCTATGCATCGTTAGAAGCCTACTGCAAACAGAAATACCCCGAACAGCCCGGGAGATTTGCTAAACTTCTCCTACGCCTGCCAGCTCTACGATCTATTGGCCTCAAATGTCTGGAACACCTCTTCTTCTTCAAACTAATAAGAGACACACCAATCGACACTTTCTTAATGGAGATGCTGGAAGCCCCTCACCAAATGACTTAAGAAAAATGGAGATCTTTCGTTTGTGCGTTGAGGGCTATGGACTCCTTGTTGGACGCCCTCAGGGACACTTTGGTCTCCAGGACACCTACAGCGGGAAAAAAAAGAAACCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)