Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-xlk8i12ex.5                           5 END     1          25       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6865319.5.5                    16 PI      75        979     1487                dystrophin (muscular dystrophy, Duchenne and Becker types) [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:6875180.5                       3 PI      90       1270     1512                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012796535 Xl3.1-IMAGE:7393678.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7393678.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAAGTGGGACAGCCTGAACTCTCAGGCCAGCAGTTGGCAGAAGCAAGTGGACAAAGCCTTGGAGAAGCTGAAGGAGTTACAAAGTGCAATGGAAGAACTGGATGTGGAGTTAATGAGTGCAGAACGAATACGGGGAAGCTGGAAACCTGTAGGAGATCTGTTAATTGATTCCTTGAAGGATCACATTGAGACAACAACAGCATTTGGAGAGGAAATTGCCCCAGTCAGCTCTAAAGTACAAACACTGAATGATATGGCCAGTCAGCTTTGTACCTTTGACATTCAGCCATCTGCAAAAACATCTCGCCAGTTGGATGACCTGAACATCAGATGGAAGCTTTTACAGGCAGCTGTTGAAGAACGTCTCAAACAACTCCAAGAAGCACATCGGGATTTTGGACCTGCCTCCCAACACTTTCTCTCTACTTCAGTTCAGCTTCCATGGCAGCGGTCAGTATCACTCAACAAAGTACCCTACTACATCAACCATCAAACACAAACTACTTGTTGGGATCACCCAAAAATGACAGAACTTTATCAGTCTCTAGGTGACTTAAATAATGTGCGCTTCTCTGCTTATCGTACTGCCATGAAGATAAGACGACTACAGAAAACCTTGTGCTTGGACCTCCTGGATCTGACTACAACACACAGCGTTTTCAAACAACATGAACTAAATCAAAGCAATCAATTGCTGTCAGTCCCTGAAGTTATCAGTGTCCTCACTACTATCTATGATGGGCTAGAGCAGAAGCACAAGGAACTGGTGAATGTACCACTCTGCATCGAAATGTGTCTGAATTGGCTGCTAAATGTGTATGACACGGGTCGAACTGGTAAACTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTTTTTAAGGAAGTATGTGGGGCAGGAGATACATGTGACCAGAGACAGCTCGGCTTGATGCTTCATGATGCCATCCAAATCCCACGTCAGCTTGGGGAAGTCGCAGCTTTTGGAGGAAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCAGAAATTGACGTCAAACATTTCATTGAGTGGATGCGCTTGGAACCTCAGTCTATTGTATGGCTACCTGTACTTCACAGAGTAGCCGCCGCTGAAACAGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGTTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGGGAAGACGTTCGGGACTTCACCAAGGTGCTGAAAAACAATTCCGCTCTAGANATATTTTGACAAGCACCCCANGCTAGGTTACTTGCCCAGTCAGACTGTCCTGGAANGGGATACATGGAGACTCCCTATACCCTATCAGCATGTGGCCTG
                                                  Xl3.1-CHK-1012707889                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGACAGCCTGAACTCTCAGGCCAGCAGTTGGCAGAAGCAAGTGGACAAAGCCTTGGAGAAGCTGAAGGAGTTACAAAGTGCAATGGAAGAACTGGATGTGGAGTTAATGAGTGCAGAACGAATACGGGGAAGCTGGAAACCTGTAGGAGATCTGTTAATTGATTCCTTGAAGGATCACATTGAGACAACAACAGCATTTGGAGAGGAAATTGCCCCAGTCAGCTCTAAAGTACAAACACTGAATGATATGGCCAGTCAGCTTTGTACCTTTGACATTCAGCCATCTGCAAAAACATCTCGCCAGTTGGATGACCTGAACATCAGATGGAAGCTTTTACAGGCAGCTGTTGAAGAACGTCTCAAACAACTCCAAGAAGCACATCGGGATTTTGGACCTGCCTCCCAACACTTTCTCTCTACTTCAGTTCAGCTTCCATGGCAGCGGTCAGTATCACTCAACAAAGTACCCTACTACATCAACCATCAAACACAAACTACTTGTTGGGATCACCCAAAAATGACAGAACTTTATCAGTCTCTAGGTGACTTAAATAATGTGCGCTTCTCTGCTTATCGTACTGCCATGAAGATAAGACGACTACAGAAAACCTTGTGCTTGGACCTCCTGGATCTGACTACAACACACAGCGTTTTCAAACAACATGAACTAAATCAAAGCAATCAATTGCTGTCAGTCCCTGAAGTTATCAGTGTCCTCACTACTATCTATGATGGGCTAGAGCAGAAGCACAAGGAACTGGTGAATGTACCACTCTGCATCGAAATGTGTCTGAATTGGCTGCTAAATGTGTATGACACGGGTCGAACTGGTAAACTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTTTTTAAGGAAGTATGTGGGGCAGGAGATACATGTGACCAGAGACAGCTCGGCTTGATGCTTCATGATGCCATCCAAATCCCACGTCAGCTTGGGGAAGTCGCAGCTTTTGGAGGAAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCAGAAATTGACGTCAAACATTTCATTGAGTGGATGCGCTTGGAACCTCAGTCTATTGTATGGCTACCTGTACTTCACAGAGTAGCCGCCGCTGAAACAGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGTTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGGGAAGACGTTCGGGACTTCACCAAGGTGCTGAAAAACAATTCCGCTCTAGANATATTTTGACAAGCACCCCANGCTAGGTTACTTGCCCAGTCAGACTGTCCTGGAANGGGATACATGGAGACTCCCTATACCCTATCAGCATGTGGCCTGACAGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Xl ---- 5e-035     AAH46265.1 Similar to dystrobrevin alpha [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ci ==== 6e-095     CAA68087.1 dystrophin [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-111     NP_492946.1 Dystrophin DYS-1 (417.4 kD) (dys-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 4e-128     XP_319450.4 AGAP010261-PA [Anopheles gambiae str. PEST] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-130     NP_001036728.1 dystrophin CG34157-PF, isoform F [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bt ---- 3e-148     NP_001103554.1 dystrophin (muscular dystrophy, Duchenne and Becker types) [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 9e-164     NP_999661.1 dystrophin-like protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xt ---- 4e-165     NP_001096188.1 dystrophin related protein 2 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 1e-180     XP_001342308.1 PREDICTED: similar to dystrophin related protein 2 [Danio rerio] ------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_419648.2 PREDICTED: similar to utrophin (dystrophin related protein) [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_035812.3 utrophin [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cf ---- 0          NP_001012395.1 utrophin [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_009055.2 utrophin [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          XP_001788213.1 PREDICTED: similar to putative utrophin [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7393678.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TGA------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2      skin Tbd7      out                        XL087e22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAAGTGGGACAGCCTGAACTCTCAGGCCAGCAGTTGGCAGAAGCAAGTGGACAAAGCCTTGGAGAAGCTGAAGGAGTTACAAAGTGCAATGGAAGAACTGGATGTGGAGTTAATGAGTGCAGAACGAATACGGGGAAGCTGGAAACCTGTAGGAGATCTGTTAATTGATTCCTTGAAGGATCACATTGAGACAACAACAGCATTTGGAGAGGAAATTGCCCCAGTCAGCTCTAAAGTACAAACACTGAATGATATGGCCAGTCAGCTTTGTACCTTTGACATTCAGCCATCTGCAAAAACATCTCGCCAGTTGGATGACCTGAACATCAGATGGAAGCTTTTACAGGCAGCTGTTGAAGAACGTCTCAAACAACTCCAAGAAGCACATCGGGATTTTGGACCTGCCTCCCAACACTTTCTCTCTACTTCAGTTCAGCTTCCATGGCAGCGGTCAGTATCACTCAACAAAGTACCCTACTACATCAACCATCAAACACAAACTACTTGTTGGGATCACCCAAAAATGACAGAACTTTATCAGTCTCTAGGTGACTTAAATAATGTGCGCTTCTCTGCTTATCGTACTGCCATGAAGATAAGACGACTACAGAAAACCTTGTGCTTGGACCTCCTGGATCTGACTACAACACACAGCGTTTTCAAACAACATGAACTAAATCAAA
  5   1   2       add Ooc3                            IMAGE:3472435.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACAAAGTACCCTACTACATCAACCATCAAACACAAACTACTTGTTGGGATCACCCAAAAATGACAGAACTTTTTCAGTCTCTAGGTGACTTAAATAATGTGCGCTTTTCTGCTTATCGCACTGCCATGAAGATAAGAAGACTACAGAAAACATTGTGCTTGGACCTCCTGGATCTGAGTACAACAAACAGTGTTTTCAAACAACATGAACTGAATCAAAGCAATCAATTGCTGTCAGTCCCTGAAGTTATCAGTGTCCTCACTACTATCTATGATGGGCTAGAGCAGAAGCACAAGGAACTGGTGAATGTACCACTCTGCATCGATATGAGTCTGAATTGGCTGCTAAATGTGTATGACACGGGTCGAACTGGTAAACTACGAGTCTTGTCCCTGAAAATTGGACTCATGTGTTTATCTAAAGGCCTACTAGAAGAGAAATACAGACATCTCTTTAAAGAAGTATGTGGAGCAGGAGATACATGTGACCAGAGACAGCTCGGCTTGCTACTTCATGATGCCATCCAAATTCCACGCCAACTTGGGGAAGTGGCAGCTTTTGGAGGGAGTAAC
  5   1   2      seed Te2                             IMAGE:7393678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCAAAATGACAGAACTTTATCAGTCTCTAGGTGACTTAAATAATGTGCGCTTCTCTGCTTATCGTACTGCCATGAAGATAAGACGACTACAGAAAACCTTGTGCTTGGACCTCCTGGATCTGACTACAACACACAGCGTTTTCAAACAACATGAACTAAATCAAAACAATCAACTGCTGTCAGTCCCTGAAGTTATCAATGTCCTCACAACCATCTATGATGGACTAGAGCAGAAGCACAAGGAACTGGTGAATGTACCACTCTGCATCGAAATGTGTCTGAATTGGCTGCTAAATGTGTATGACACGGGTCGAACTGGTAAACTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTTTTTAAGGAAGTATGTGGGGCAGGAGATACATGTGACCAGAGACAGCTCGGCTTGATGCTTCATGATGCCATCCAAATCCCACGTCAGCTTGGGGAAGTCGCAGCTTTTGGAGGAAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCAGAAATTGACGTCAAACATTTCATTGAGTGGATGCGCTTGGAACCTCAGTCTATTGTATGGCTACCTGTACTTCACAGAGTAGCCGCCGCTGAACAGCTAAGCATCAGCCAAGTGTACATCTGTAAAGATGCCTCATTGTGGATCCGTACAGAGTTAAGCATTTACTTGAGTGTGCAAGTGCTCTTTCTGGAGACACAAGGTCCAGTACTCTCATGTGGAATGCTCTAAATCGGGAGACTCGATCCA
  5   1   2       bld Sp1                             IMAGE:4965374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGCAGAAGCACAAGGAACTGGTGAATGTACCACTCTGCATCGAAATGTGTCTGAATTGGCTGCTAAATGTGTATGACACGGGTCGAACTGGTAAACTACGAGTCTTGTCCCTGAAGATTGGGCTCATGTGTTTATCTAAAGGCCTTCTAGAAGAGAAATACAGACATCTTTTTAAGGAAGTATGTGGGGCAGGAGATACATGTGACCAGAGACAGCTCGGCTTGATGCTTCATGATGCCATCCAAATCCCACGTCAGCTTGGGGAAGTCGCAGCTTTTGGAGGAAGTAACATTGAGCCAAGTGTACGCAGCTGCTTTCAACATGCTCAAAATAAACCAGAAATTGACGTCAAACATTTCATTGAGTGGATGCGCTTGGAACCTCAGTCTATTGTATGGCTACCTGTACTTCACAGAGTAGCCGCCGCTGAAACAGCTAAGCATCAAGCCAAGTGTAACATCTGTAAAGAATGCCCCATTGTTGGATTCAGGTACAGGAGTCTAAAGCATTTTAACTATGATGTGTGCCAAAGTTGCTTCTTTTCTGGAAGGACAGCAAAGGGTCACAAGTTACATCACCCAATGGTGGAATACTGCACTCCTACAACATCAGGGGAAGACGTTCGGGACTTCACCAAGGTGCTGAAAAACAATTCCGCTCTAGANATATTTTGACAAGCACCCCANGCTAGGTTACTTGCCCAGTCAGACTGTCCTGGAANGGGATACATGGAGACTCCCTATACCCTATCAGCATGTGGCCTGACAGTTNGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)