Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 21 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL449e07ex.5                          9 END     1          25       11                (no blast hit)
     2   1.0    0Xl3.1-IMAGE:6948454.3                       4 END     1          25       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xl331k13.5                            5 PI      93        201      573                transcription factor Sox9b [Xenopus laevis]

 This cluster: approximate FL confidence score = 89%

 1012796617 Xl3.1-IMAGE:7978240.5 - 4 ESTs
                                                                       ...-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7978240.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGCAGTGTGTGTGAGCGGAGAGGGAGGAGAGGCTATCTCTGTACCCAACTAATTGCGCACTGGGGTGCAAGGGCTGAGCACTGTGCATAACTGAAGGGGCTGGCGTGTCAGTCTCCCCTTTGATTTTGGGTGCCTTTGCTGAAGAGCAGATTTGGTCATTTTCATTGAGACTGAGGTGCGGGAAGACGCAGACACTGCCGAACTCTCTTCTCCAACTTTCTTACCTTTCCCCATTTTTGCGCATGAATCTCTTGGATCCCTTCATGAAGATGACAGAAGAGCAAGATAAGTGCATGTCCGGGGCTCCCAGCCCAACAATGTCCGACGACTCGGCAGGTTCCCCATGTCCCTCTGGCTCCGGCTCCGACACGGAGAACACCAGACCCCAAGAAAACACTTTCCCCAAAGGGGACCAGGAGCTGAAGAAGGAGACGGAGGATGAGAAGTTCCCCGTGTGCATCAGAGAAGCGGTCAGCCAGGTGTTGAAGGGATATGATTGGACCCTGGTACCGATGCCAGTCAGAGTTAATGGATCCAGCAAGAACAAGCCCCATGTCAAGAGACCCATGAACGCCTTCATGGTCTGGGCACAGGCTGCAAGGAGGAAGCTGGCTGATCAGTACCCCCATCTGCACAATGCAGAACTCAGCAAGACGCTGGGAAAGTTATGGAGACTTCTGAATGAGGGTGAGAAACGCCCTTTCGTGGAGGAGCAGAGGAGGCTGAGGGTCCAACACAAGAAGGATCATCCCGACTACAAGTATCAGCCACGGCGCAGAAAGTCCGTTAAGAATGGGCAGACAGAACAAGAGGATGGTGCTGAGCAAACCCACATCTCCCCTAATGCAATTTTCAAGGCCCTACAGGCTGACTCCCCGCATTCCTCTTCCAGCATGAGCGAAGTCCACTCTCCTGGAGAACATTCAGGTCAATCCCAAGGCCCACCAACTCCTCCAACTACTCCCAAGACAGATATCCAGCCTGGAAAGCCAGACCTAAAGAGGGAGGGCAGGCCACTGCAAGAGAACGGTAGGCAGCCACCTCACATTGATTTCCGAGATGTGGACATTGGTGAGCTGAGCAGTGAGGTCATCTCCACCATTGAAACCTTTGATGTCAATGAATTTGACCAATACCTGCCGCCCAATGGCCACCCAGGGGTTGGCTCCACTCAGGCCTCGTACACAGGCAGTTATGGCATCAGCAGCACCCCTAGTGCCACTACAGGTGCTGGTTCTGCCTGGATGTCTAAACAGCAACAGCAGCCTCAGCAACACTCACTGTCAACCATAAACAGCGAGCAAAGCCAGTCCCAGCAAAGGACACACATCAAGACTGAGCAACTGAGCCCAAGTCATTACAGTGACCAGCAGCAACAGCACTCCCCCCAGCAACTGAACTACAGCTCCTTCAACCTACAGCATTACAGCTCTTCCTACCCAACCATCACCCGGGCACAGTATGACTACACAGAGCACCAGGGCTCCAACTCCTATTACACTCACGCAAGTGGTCAAAATTCTGGTCTCTACTCCAACTTTACCTACATGAATCCAAGCCAACGCCCCATGTACACCCCTATTGCAGACACAACGGGAGTTCCATCATCCCCAGACCACAGCCACAGCATGGAGCAGCTGTCTATACCACTCACAGACCTAGAATGGATAGACATGACTTTCTAGACTGAACCCATCCTGTGAGAGTGCGCTCATGTCCACATATGTGACTTCACGACTGGACAAGACACTAGATCTAGGTACACATGTGTGCAGACGCTAGATACATCGATGACAGCTGGAGACGTAACGGCCTAGTTATA
                                                  Xl3.1-CHK-1012708493                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGTGTGTGAGCGGAGAGGGAGGAGAGGCTATCTCTGTACCCAACTAATTGCGCACTGGGGTGCAAGGGCTGAGCACTGTGCATAACTGAAGGGGCTGGCGTGTCAGTCTCCCCTTTGATTTTGGGTGCCTTTGCTGAAGAGCAGATTTGGTCATTTTCATTGAGACTGAGGTGCGGGAAGACGCAGACACTGCCGAACTCTCTTCTCCAACTTTCTTACCTTTCCCCATTTTTGCGCATGAATCTCTTGGATCCCTTCATGAAGATGACAGAAGAGCAAGATAAGTGCATGTCCGGGGCTCCCAGCCCAACAATGTCCGACGACTCGGCAGGTTCCCCATGTCCCTCTGGCTCCGGCTCCGACACGGAGAACACCAGACCCCAAGAAAACACTTTCCCCAAAGGGGACCAGGAGCTGAAGAAGGAGACGGAGGATGAGAAGTTCCCCGTGTGCATCAGAGAAGCGGTCAGCCAGGTGTTGAAGGGATATGATTGGACCCTGGTACCGATGCCAGTCAGAGTTAATGGATCCAGCAAGAACAAGCCCCATGTCAAGAGACCCATGAACGCCTTCATGGTCTGGGCACAGGCTGCAAGGAGGAAGCTGGCTGATCAGTACCCCCATCTGCACAATGCAGAACTCAGCAAGACGCTGGGAAAGTTATGGAGACTTCTGAATGAGGGTGAGAAACGCCCTTTCGTGGAGGAGCAGAGxxGxxxGAGGGTCCAACACAAGAAGGATCATCCCGACTACAAGTATCAGCCACGGCGCAGAAAGTCCGTTAAGAATGGGCAGACAGAACAAGAGGATGGTGCTGAGCAAACCCACATCTCCCCTAATGCAATTTTCAAGGCCCTACAGGCTGACTCCCCGCATTCCTCTTCCAGCATGAGCGAAGTCCACTCTCCTGGAGAACATTCAGGTCAATCCCAAGGCCCACCAACTCCTCCAACTACTCCCAAGACAGATATCCAGCCTGGAAAGCCAGACCTAAAGAGGGAGGGCAGGCCACTGCAAGAGAACGGTAGGCAGCCACCTCACATTGATTTCCGAGATGTGGACATTGGTGAGCTGAGCAGTGAGGTCATCTCCACCATTGAAACCTTTGATGTCAATGAATTTGACCAATACCTGCCGCCCAATGGCCACCCAGGGGTTGGCTCCACTCAGGCCTCGTACACAGGCAGTTATGGCATCAGCAGCACCCCTAGTGCCACTACAGGTGCTGGTTCTGCCTGGATGTCTAAACAGCAACAGCAGCCTCAGCAACACTCACTGTCAACCATAAACAGCGAGCAAAGCCAGTCCCAGCAAAGGACACACATCAAGACTGAGCAACTGAGCCCAAGTCATTACAGTGACCAGCAGCAACAGCACTCCCCCCAGCAACTGAACTACAGCTCCTTCAACCTACAGCATTACAGCTCTTCCTACCCAACCATCACCCGGGCACAGTATGACTACACAGAGCACCAGGGCTCCAACTCCTATTACACTCACGCAAGTGGTCAAAATTCTGGTCTCTACTCCAACTTTACCTACATGAATCCAAGCCAACGCCCCATGTACACCCCTATTGCAGACACAACGGGAGTTCCATCATCCCCAGACCACAGCCACAGCATGGAGCAGCTGTCTATACCACTCACAGACCTAGAATGGATAGACATGACTTTCTAGACTGAACCCATCCTGTGAGAGTGCGCTCATGTCCACATATGTGACTTCACGACTGGACAAGACACTAGATCTAGGTACACATGTGTGCAGACGCTAGATACATCGATGACAGCTGGAGACGTAACGGCCTAGTTATATGAATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     244     464                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     244     261                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-026     NP_510439.1 SOX (mammalian SRY box) related (sox-3) [Caenorhabditis elegans] ------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dm ==== 1e-035     NP_651839.1 CG15552-PA [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 5e-059     CAD58841.1 SoxE protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 2e-059     XP_001177295.1 PREDICTED: similar to Sox9 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 6e-112     XP_608786.4 PREDICTED: similar to SRY-box containing gene 8 (predicted) [Bos taurus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Bt ---- 1e-129     XP_884399.2 PREDICTED: similar to Sox10 protein isoform 8 [Bos taurus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 0          NP_571718.1 SRY-box containing gene 9a [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Cf ==== 0          NP_001002978.1 SRY (sex determining region Y)-box 9 [Canis familiaris] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 0          NP_035578.3 SRY-box containing gene 9 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 0          NP_000337.1 transcription factor SOX9; SRY (sex-determining region Y)-box 9; SRY(sex-determining region Y)-box 9 (campomelic dysplasia, autosomal sex-reversal);SRY (sex-determining region Y)-box 9 protein [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 0          NP_989612.1 SRY (sex determining region Y)-box 9 (campomelic dysplasia, autosomal sex-reversal) [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          CAJ82635.1 SRY (sex determining region Y)-box 9 (campomelic dysplasia, autosomal sex-reversal) [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          BAG48176.1 transcription factor Sox9b [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7978240.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---ATG---------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------ATG------------------------------------------ATG------TAG---------------TGA---------------------------------------------------------------------------------------ATG---------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2      seed Emb9 5g                         IMAGE:7978240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGCAGTGTGTGTGAGCGGAGAGGGAGGAGAGGCTATCTCTGTACCCAACTAATTGCGCACTGGGGTGCAAGGGCTGAGCACTGTGCATAACTGAAGGGGCTGGCGTGTCAGTCTCCCCTTTGATTTTGGGTGCCTTTGCTGAAGAGCAGATTTGGTCATTTTCATTGAGACTGAGGTGCGGGAAGACGCAGACACTGCCGAACTCTCTTCTCCAACTTTCTTACCTTTCCCCATTTTTGCGCATGAATCTCTTGGATCCCTTCATGAAGATGACAGAAGAGCAAGATAAGTGCATGTCCGGGGCTCCCAGCCCAACAATGTCCGACGACTCGGCAGGTTCCCCATGTCCCTCTGGCTCCGGCTCCGACACGGAGAACACCAGACCCCAAGAAAACACTTTCCCCAAAGGGGACCAGGAGCTGAAGAAGGAGACGGAGGATGAGAAGTTCCCCGTGTGCATCAGAGAAGCGGTCAGCCAGGTGTTGAAGGGATATGATTGGACCCTGGTACCGATGCCAGTCAGAGTTAATGGATCCAGCAAGAACAAGCCCCATGTCAAGAGACCCATGAACGCCTTCATGGTCTGGGCACAGGCTGCAAGGAGGAAGCTGGCTGATCAGTACCCCCATCTGCACAATGCAGAACTCAGCAAGACGCTGGGAAAGTTATGGAGACTTCTGAATGAGGGTGAGAAACGCCCTTTCGTGGAGGAGCAGAGAGGCTGAGGTCCAACACAAGAAGGATCATCCCGACTACAAGTATCAGCCACGGCGCAGAAAAGTCCGTTTAAGAATTGGGCAGACAGGAACCA
  5   1   2       bld Tbd7 5g3  out                        XL094d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGGAGGAGAGGCTATCTCTGTACCCAACTAATTGCGCACTGGGGTGCAAGGGCTGAGCACTGTGCATAACTGAAGGGGCTGGCGTGTCAGTCTCCCCTTTGATTTTGGGTGCCTTTGCTGAAGAGCAGATTTGGTCATTTTCATTGAGACTGAGGTGCGGGAAGACGCAGACACTGCCGAACTCTCTTCTCCAACTTTCTTACCTTTCCCCATTTTTGCGCATGAATCTCTTGGATCCCTTCATGAAATATGACAGAAGAGCAAGATAAGTGCATGTCCGGGGCTCCCAGCCCAACAATGTCCGACGACTCGGCAGGTTCCCCATGTCCCTCTGGCTCCGGCTCCGACACGGAGAACACCAGACCCCAAGAAAACACTTTCCCCAAAGGGGACCAGGAGCTGAAGAAGGAGACGGAGGATGAGAAGTTCCCCGTGTGCATCAGAGAAGCGGTCAGCCAGGTGTTGAAGGGATATGATTGGACCCTGGTACCGATGCCAGTCAGAGTTAATGGATCCAGCAAGAACAAGCCCCATGTCAAGAGACCCATGAACGCCTTCATGGTCTGGGCACAGGCTGCAAGGAGGAAGCTGGCTGATCAGTACCCCCATCTGCACAATGCAGAACTCAGCAAGACGCTGGGAAAGTTAT
  5   1   1       add Emb4                            IMAGE:5515589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCACGCGTCCGAACGCTGAACTCAGCAAGACGCTGGGAAAGTTATGGAGACTTCTGAATGAGGGTGAGAAACGCCCTTTCGTGGAGGAAGCAGAGAGGCTGAGGGTCCAACACAAGAAGGATCATCCCGACTACAAGTATCAGCCACGGCGCAGAAAGTCCGTTAAGAATGGGCAGACAGAACAAGAGGATGGTGCTGAGCAAACCCACATCTCCCCTAATGCAATTTTCAAGGCCCTACAGGCTGACTCCCCGCATTCCTCTTCCAGCATGAGCGAAGTCCACTCTCCTGGAGAACATTCAGGTCAATCCCAAGGCCCACCAACTCCTCCAACTACTCCCAAGACAGATATCCAGCCTGGAAAGCCAGACCTAAAGAGGGAGGGCAGGCCACTGCAAGAGAACGGTAGGCAGCCACCTCACATTGATTTCCGAGATGTGGACATTGGTGAGCTGAGCAGTGAGGTCATCTCCACCATTGAAACCTTTGATGTCAATGAATTTGACCAATACCTGCCGCCCAATGGCCACCCAGGGGTTGGCTCCACTCAGGCCTCGTACACAGGCAGTTATGGCATCAGCAGCACCCCTAGTGCAACCACAGGTGCTGGCCCTGCCTGGATGTCTAAACAACAGCAACAGCAGCCTCAACAACATTCACTGTCAACCCTAAACAGCGAGCAAAGCCAGTCCCAGCAAAGGACACACATCANGACCGAGCAACTGAGTCCNAGTCATTACAGTGACCAACAGCAACAGCATTCCCCCCAGCAGCTGAACTACAGCTTCTTCA
  5   1   1       add Te2N      out                   IMAGE:7765377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCAACCACCCCCAAGACAGATGTCCAGCCTGGAAAGCCAGACTTGAAGAGGGAGGGCAGGCCACTGCAGGAGAGCGGTAGGCAACCGCCTCACATTGATTTCCGTGATGTGGACATTGGTGAGCTGAGCAGTGAGGTCATCTCCACCATCGAAACCTTTGACGTCAATGAATTTGACCAGTACCTGCCACCCAATGGCCACCCAGGGGTCGGCTCCGCTCAGGCCCCGTACACAGGCAGTTATGGCATCAGCAGCACCCCTAGTGCCACTACAGGTGCTGGTTCTGCCTGGATGTCTAAACAGCAACAGCAGCCTCAGCAACACTCACTGTCAACCATAAACAGCGAGCAAAGCCAGTCCCAGCAAAGGACACACATCAAGACTGAGCAACTGAGCCCAAGTCATTACAGTGACCAGCAGCAACAGCACTCCCCCCAGCAACTGAACTACAGCTCCTTCAACCTACAGCATTACAGCTCTTCCTACCCAACCATCACCCGGGCACAGTATGACTACACAGAGCACCAGGGCTCCAACTCCTATTACACTCACGCAAGTGGTCAAAATTCTGGTCTCTACTCCAACTTTACCTACATGAATCCAAGCCAACGCCCCATGTACACCCCTATTGCAGACACAACGGGAGTTCCATCATCCCCAGACCACAGCCACAGCATGGAGCAGCTGTCTATACCACTCACAGACCTAGAATGGATAGACATGACTTTCTAGACTGAACCCATCCTGTGAGAGTGCGCTCATGTCCACATATGTGACTTCACGACTGGACAAGACACTAGATCTAGGTACACATGTGTGCAGACGCTAGATACATCGATGACAGCTGGAGACGTAACGGCCTAGTTATATGAATATCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)