Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-IMAGE:3581609.5                       6 END     2          66       33                XFD-11 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL093l08.3                            6 PI      89        122      960                hypothetical protein LOC734912 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012796678 Xl3.1-IMAGE:5514684.5 - 3 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5514684.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGGGCTCCCTCTACAGCTCCCCCTGCAGTCAGGGCACAAGCAGTGGCGGTGGGGCAGGGACCTATCACTGTAATATGCAGGCCATGAGCTTGTAATTCTGGGGACAGTCGGGACACTTAACTCCTGCCAAACACCCCAGCAGCACCACAGTGGAAAGAGACCTTACCTGACTATTCCACTCTACCACCTCTGCCCAGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCCTCTTGGTATCTCAATCAAACTGGGAATTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAGCGATTAGCTTTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTATCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGCTGAAAACAGCTTTCCAAAATATTTTTTTTTATAATTTTTATCTAATAGGGATTTTTTAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATTAATGTACCTGGATTGTGTGGACCAAAAAAACGCCAGGCAGTGGCGATCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAATAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTGTTTTCTTGTTTTGAAA
                                                  Xl3.1-CHK-1012712683                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCCTCTACAGCTCCCCCTGCAGTCAGGGCACAAGCAGTGGCGGTGGGGCAGGGACCTATCACTGTAATATGCAGGCCATGAGxxTxxxATTCTGGGxxxxGTCGGGACACTTAACTCCTGCCAAxxxCCCCAGCAGCxxCxxAGTGGAAxxxxxCCTTACCTGACTxTxCxxCTCTACCxxCxxxxxCCxGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGxxTxxCCCTCTTGGTATCTCAATCAAxxxGGGAATTTGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAGCGATTAGCTTTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTATCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGCTGAAAACAGCTTTCCAAAATATTTTTTTTTATAATTTTTATCTAATAGGGATTTTTTAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATTAATGTACCTGGATTGTGTGGACCAAAAAAACGCCAGGCAGTGGCGATCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAATAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTGTTTTCTTGTTTTGAAAATNTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                                                                                                                  PROTEIN --- Gg ---- 6e-013     NP_990469.1 winged helix transcriptional factor MFH-1 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PREDICTED - ?? ---- 3e-014     XP_872296.3 PREDICTED: similar to forkhead box C2 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PREDICTED - Cf ---- 2e-016     XP_546791.2 PREDICTED: similar to Forkhead box protein C2 (Forkhead-related protein FKHL14) (Mesenchyme fork head protein 1) (MFH-1 protein) (Transcription factor FKH-14) isoform 1 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-041     NP_032618.2 forkhead box C1; mesoderm/mesenchyme forkhead 1; congenital hydrocephalus [Musmusculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-041     NP_001444.2 forkhead box C1 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 9e-046     XP_001918817.1 PREDICTED: hypothetical protein [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-065     NP_001007864.1 foxc1-prov protein [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-069     NP_001080937.1 winged helix transcription factor XFD-11 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5514684.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------ATG---------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------TGA---------TGA---------------------------------------TAATAG---------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------TAA---------------------------ATG------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                             ]
  3   1   2      seed Ga18      out                     xlk157d23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNNANNACAnnnnnnnnnCCCnnnnTnnnCCCTnnCCTnCnCCCnnnnnnANGNCTCCNTCTACANNTCCCCCTGNAGNNNNGNNACAAGNAGTGGNNNTGGNGNNAGGGNCCTATNACTGTAATATNCAGGCCATGNGCTTGTATTCTGGGGACAGNTCGGNCCACTTAACNCCTNNCAACACCCCAGCAGCCACCACAGNGGAAGAGACCTTACCTGACTATTCCATCTCTNCCACCTCTGCCCAGNNNCATGGCANCCAGGAGNACCCTCACCAGGNCCGATTGCCCTCTTGGTATCTCAATCAAACTGNGGAATTGGCCACTTGGCCGGGNCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAGCGATTAGCTTTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTATCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGCTGAAAACAGCTTTCCAAAATATTTTTTTTTATnnTTTTTATCTAATAGGGATTTTTTAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATTAATGTACCTGGATTGTGTGGACCAAAAAAACNCCAGGCAGTGGCGATCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAATAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTGTTTTCTTGTTTTGAAAATNTCTCGANNNNNCANNNCCGTTTNT
  5   1   1       add Emb4                            IMAGE:5514684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGCCAGGGCTCCCTCTACAGCTCCCCCTGCAGTCAGGGCACAAGCAGTGGCGGTGGGGCAGGGACCTATCACTGTAATATGCAGGCCATGAGCTTGTATTCTGGGGACAGGTCGGGACACTTAACTCCTGCCAACACCCCAGCAGCCACCACAGTGGAAGAGACCTTACCTGACTATTCCATCTCTACCACCTCTGCCCAGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAACTGGGGAATTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAGCGATTAGCTTTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTATCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGCTGAAAACAGCTTTCCAAAATAtttttttttataatttttatctaatagggattttttAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTTCCCTGTGTTAAGAGCGtatattatatatatatatatatatatGAACAGCTTCCATAGACTTTGTCTCAGATGTAAANTTGCATATAGA
  3   1   2       bld Tbd7      out                        XL062l24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCTTTCCAAAATATTTTTTTTTATAATTTTTATCTAATAGGGATTTTTTAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATATATGACAAGATTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATTAATGTACCTGGATTGTGTGGACCAAAAAAACGCCAGGCAGTGGCGATCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAATAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTGTTTTCT

In case of problems mail me! (