Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 09 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-IMAGE:3581609.5                       6 END     2          66       33                XFD-11 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL093l08.3                            6 PI      89        122      960                hypothetical protein LOC734912 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012796678 Xl3.1-IMAGE:5514684.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5514684.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGGGCTCCCTCTACAGCTCCCCCTGCAGTCAGGGCACAAGCAGTGGCGGTGGGGCAGGGACCTATCACTGTAATATGCAGGCCATGAGCTTGTAATTCTGGGGACAGTCGGGACACTTAACTCCTGCCAAACACCCCAGCAGCACCACAGTGGAAAGAGACCTTACCTGACTATTCCACTCTACCACCTCTGCCCAGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCCTCTTGGTATCTCAATCAAACTGGGAATTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAGCGATTAGCTTTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTATCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGCTGAAAACAGCTTTCCAAAATATTTTTTTTTATAATTTTTATCTAATAGGGATTTTTTAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATTAATGTACCTGGATTGTGTGGACCAAAAAAACGCCAGGCAGTGGCGATCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAATAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTGTTTTCTTGTTTTGAAA
                                                  Xl3.1-CHK-1012712683                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCCTCTACAGCTCCCCCTGCAGTCAGGGCACAAGCAGTGGCGGTGGGGCAGGGACCTATCACTGTAATATGCAGGCCATGAGxxTxxxATTCTGGGxxxxGTCGGGACACTTAACTCCTGCCAAxxxCCCCAGCAGCxxCxxAGTGGAAxxxxxCCTTACCTGACTxTxCxxCTCTACCxxCxxxxxCCxGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGxxTxxCCCTCTTGGTATCTCAATCAAxxxGGGAATTTGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAGCGATTAGCTTTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTATCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGCTGAAAACAGCTTTCCAAAATATTTTTTTTTATAATTTTTATCTAATAGGGATTTTTTAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATTAATGTACCTGGATTGTGTGGACCAAAAAAACGCCAGGCAGTGGCGATCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAATAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTGTTTTCTTGTTTTGAAAATNTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                                                                                                                  PROTEIN --- Gg ---- 6e-013     NP_990469.1 winged helix transcriptional factor MFH-1 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PREDICTED - ?? ---- 3e-014     XP_872296.3 PREDICTED: similar to forkhead box C2 [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PREDICTED - Cf ---- 2e-016     XP_546791.2 PREDICTED: similar to Forkhead box protein C2 (Forkhead-related protein FKHL14) (Mesenchyme fork head protein 1) (MFH-1 protein) (Transcription factor FKH-14) isoform 1 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-041     NP_032618.2 forkhead box C1; mesoderm/mesenchyme forkhead 1; congenital hydrocephalus [Musmusculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-041     NP_001444.2 forkhead box C1 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 9e-046     XP_001918817.1 PREDICTED: hypothetical protein [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-065     NP_001007864.1 foxc1-prov protein [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-069     NP_001080937.1 winged helix transcription factor XFD-11 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5514684.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------ATG---------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------TGA---------TGA---------------------------------------TAATAG---------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------TAA---------------------------ATG------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                             ]
  3   1   2      seed Ga18      out                     xlk157d23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNNANNACAnnnnnnnnnCCCnnnnTnnnCCCTnnCCTnCnCCCnnnnnnANGNCTCCNTCTACANNTCCCCCTGNAGNNNNGNNACAAGNAGTGGNNNTGGNGNNAGGGNCCTATNACTGTAATATNCAGGCCATGNGCTTGTATTCTGGGGACAGNTCGGNCCACTTAACNCCTNNCAACACCCCAGCAGCCACCACAGNGGAAGAGACCTTACCTGACTATTCCATCTCTNCCACCTCTGCCCAGNNNCATGGCANCCAGGAGNACCCTCACCAGGNCCGATTGCCCTCTTGGTATCTCAATCAAACTGNGGAATTGGCCACTTGGCCGGGNCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAGCGATTAGCTTTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTATCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGCTGAAAACAGCTTTCCAAAATATTTTTTTTTATnnTTTTTATCTAATAGGGATTTTTTAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATTAATGTACCTGGATTGTGTGGACCAAAAAAACNCCAGGCAGTGGCGATCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAATAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTGTTTTCTTGTTTTGAAAATNTCTCGANNNNNCANNNCCGTTTNT
  5   1   1       add Emb4                            IMAGE:5514684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGCCAGGGCTCCCTCTACAGCTCCCCCTGCAGTCAGGGCACAAGCAGTGGCGGTGGGGCAGGGACCTATCACTGTAATATGCAGGCCATGAGCTTGTATTCTGGGGACAGGTCGGGACACTTAACTCCTGCCAACACCCCAGCAGCCACCACAGTGGAAGAGACCTTACCTGACTATTCCATCTCTACCACCTCTGCCCAGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAACTGGGGAATTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAGCGATTAGCTTTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTATCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGCTGAAAACAGCTTTCCAAAATAtttttttttataatttttatctaatagggattttttAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTTCCCTGTGTTAAGAGCGtatattatatatatatatatatatatGAACAGCTTCCATAGACTTTGTCTCAGATGTAAANTTGCATATAGA
  3   1   2       bld Tbd7      out                        XL062l24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCTTTCCAAAATATTTTTTTTTATAATTTTTATCTAATAGGGATTTTTTAAGAAAGGAAAAAGAACATCCTCCTCATCCAAAAATGTCCTATTTGTTAGTTTTGTACAGACAACAAAATTGTCTTGGTTTGTTAAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGATTGTGATGCATGGCAATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATATATGACAAGATTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATTAATGTACCTGGATTGTGTGGACCAAAAAAACGCCAGGCAGTGGCGATCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAATAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTGTTTTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)