Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4743271.3                       2 PI      93          1      458                T-cell factor 4 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012796701 Xl3.1-IMAGE:4755421-IMAGp.5 - 5 ESTs
                                                                       .........-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4755421-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGACCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCAGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTATCCAATCACAACGGGGGGCTTCAGGCACCCCTACCCCACAGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCTCCTCACATGGTGCCGCCTCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATAGTCAACCCTACTGTCAAGCAGGAGTCTTCCCAGAGTGACATGGGATCCCTCCACAGCTCGAAACATCAGGATTCCAAAAAAAGAGCAGGAACCCAAAAGACCTCACATAAAGAAACCTCTAAATGCGTTCATGTTGTATATGAAAGAAATGAGAGCGAATGTAGTGGCCGAGTGCACGTTAAAAGAAAGTGCTGCCATCAACCAGATTCTGG
                                                  Xl3.1-CHK-1012704837                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGACCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCAGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTATCCAATCACAACGGGGGGCTTCAGGCACCCCTACCCCACAGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCTCCTCACATGGTGCCGCCTCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATAGTCAACCCTACTGTCAAGCAGGAGTCTTCCCAGAGTGACATGGGATCCCTCCACAGCTCGAAACATCAGGATTCxxAxAAAAGAGCAGGAACCCAAAAGACCTCACATAAAGAAACCTCTAAATGCTTTCATGTTGTATATGAAAGAAATGAGAGCGAATGTAGTxGCxGAxTGCACxxTxAAAGAAAGTGCTGCCATCAACCAGATxCTxGGCCGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     5     2     5     2     5     2     5     2     5     2     5     3     5     2     5     2     5     2     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     5     2     5     2     4     2     4     3     4     2     4     3     4     3     4     2     4     2     4     2     4     3     4     3     4
                                               BLH MIN     449       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 1e-015     NP_001071831.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 1e-017     XP_320144.4 AGAP012411-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sp ---- 4e-018     NP_999640.1 HMG protein Tcf/Lef [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Bt ---- 8e-061     XP_593301.3 PREDICTED: similar to HMG-box transcription factor TCF-3 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Cf ---- 3e-085     XP_544024.2 PREDICTED: similar to Transcription factor 7-like 2 (HMG box transcription factor 4) (T-cell-specific transcription factor 4) (TCF-4) (hTCF-4) [Canis familiaris] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Mm ---- 2e-085     NP_033359.2 transcription factor 7-like 2, T-cell specific, HMG-box; transcription factor7-like 2 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 2e-085     NP_110383.2 transcription factor 7-like 2 (T-cell specific, HMG-box) [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 6e-086     XP_421760.2 PREDICTED: similar to TCF7L2 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dr ---- 6e-088     NP_571334.1 transcription factor tcf4 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xt ---- 2e-091     AAI36074.1 Unknown (protein for IMAGE:7657171) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 2e-092     NP_001083866.1 T-cell factor XTCF-4A [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4755421-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2       bld Emb4                            IMAGE:5515782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGTACCAAGCGATAACCATCCTGTGCCAAGTTGTGGATTATCTCTGCTGCAGGACATTGGCACTTGGCACCTCAATCTAAATTGCTGGTCTAACAAGGTGCCCGTTGTACAGCACCCTCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGACCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCAGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTATCCAATCACAACGGGGGGCTTCAGGCACCCCTACCCCACAGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCTCCTCACATGGTGCCGCCTCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATAGTCAACCCTACTGTCAAGCAGGAGTCTTCCCAGAGTGACATGGGATCCCTCCACAGCTCGAAACATCAGGATTCCaaaaaagaagaagaaaagaaaaagCCGCACATAAAGAAACCTCTAAATGCGTTCATGCTGTATATGAAGGAGATGAGGGCAAAAGTCGTGGCCGAGTGCACGTTAAAGAAAGCGCAGCCATCATCAGATCCTTGGCGAAGTGCACGCTTATCANGGAAGACAGCGAATATACAGCTGCGAGAAGAGAGCACTCACTGCACTTACCCGATGTCGCACGAA
  3   1   1       add DMZ                                 rxl291m13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAGGATGCAGGAAAACATCCGGATGGAGGCTTATACAGCAAAGGCCCTTCTTATACTGGATACCCAAGCTATATCATGATGCCAAATATGAATAATGAGCCTTACATGTCAAATGGATCTTTGTCTCCACCCATTCCAAGAACATCAAACAAAGTCCCAGTGGTGCAGCCATCGCACGCTGTCCATCCTCTAACCCCACTCATCACTTACAGTGACGAGCACTTTGCACCAGGAGTACACCCATCACACATCCCATCAGATATCAACACAAAGCAAGGCATGCACAGGCATCCTCAAGCACCAGACCTACCTACATTTTACCCAATGTCCCCAGGAAGTGTGGGCCAGATGACACCACCATTGGGCTGGTATCCACACCATATGGTTTCTGGTCCTCCGGGCCCTCACGCAACTGGAATTCCTCACCCAGCTATTGTCAATCCTCAGGTTAAACAAGAACATTCACACAATGACCATGACCTAATGCACATGAAACCACACCACGAACAGAGAAAAGAGCAGGAACCCAAAAGACCTCACATAAAGAAACCTTTGAATGCTTTCATGTTGTATATGAAAGAAATGAGAGCGAATGTAGTAGCAGAATGTACTCTCAAAGAAAGTGCTGCCATCAACCAGATTCTGGGAAGGAGGTGGCATGCATTGTCCCGGGAGGACCAGGCCAAATATTATGAATTAGCTCGCAAAGAAAGGCAAC
  5   1   1       add Lmb1                            IMAGE:8535191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATATNNNCCATACTGANTNNGNGAAGAGTACTAATTANTANNCGNCCCACTGGATACCCAAGCTATATCATGATGCCAAATATGAATAATGAGCCTTACATGTCAAATGGATCTTTGTCTCCACCCATTCCAAGAACATCAAACAAAGTCCCAGTGGTGCAGCCATCACACGCCGTCCATCCTCTAACCCCACTCATCACTTACAGTGACGAGCATTTTGCACCAGGAGCACACCCATCACATCTCCCATCAGATGTCAACACAAAGCAAGGCATGCACAGGCATCATCAAGTGCCGGACCTACCTACATTTTACCCACTGTCCCCAGGAAGTGTGGGCCAGATGACACCACCATTGGGCTGGTATCCACACCATATGGTTCTGGTCCTCCGGGCCATCACGCAACTGGAATTCCTCACCCAGCTATTGTCAATCCTCAGGTTAAACAAGAACATCCACACAATGACAATGACCTAATGCACATGAAACCTCACCACGAACAGAGAAAAGAGCAGGAACCCAAAAGACCTCACATAAAGAAACCTCTGAATGCTTTCATGTTGTATATGAAAGAAATGAGAGCGAATGTAGTAGCAGAATGCACTCTGAAAGAAAGTGCTGCCATCAACCAGATTCTGGGCAGAAGGTGGCATGCATTGNTCCGGGAAGAACAGTCANATATTATGAGTTAGCTCGCAAAGAAGGCAATACACATGCAGCTTTATCAAGATGTCTGCAGGGACACTACGTAAAAAAAGAGAGAAGCGGAGAACTGCAGATC
  5   1   2      seed Eye1                   IMAGE:4755421-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCACCCTCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGACCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCAGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTATCCAATCACAACGGGGGGCTTCAGGCACCCCTACCCCACAGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCTCCTCACATGGTGCCGCCTCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATAGTCAACCCTACTGTCAAGCAGGAGTCTTCCCAGAGTGACATGGGATCCCTCCACAGCTCGAAACATCAGGATTCCaaaaaaagaagaagaaaagaaaaaGCCGCACATAAAGAAACCTCTAAATGCGTTCATGCTGTATATGAAGGAGATGAGGGCAAAAGTCGTGGCCGAGTGCACGTTAAAAGAAAGCGCAGCCATCAATCAGATCCTTGGCCGAAGGTGGCACGCATTATCCAGGGAAGAGCAAGCGAAATACTACGAGCTGGCGAGGAAGGAGAGGCAACTCCACATGCAGCTTTACCCCGGATGGTCGGCACGGGATAACTATGGCAAGAAGAAGAAGAGGAAAAGGGAAAAGCAACAAGGAGAGGCCAATGACCTGAGCGCTCCTAAGAAATGTCGAGCGCGCTTTGGCCTTGA
  3   1   2       bld Tbd5                            IMAGE:3581074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAGGCCCCCCCNCCCNCCAGACNTTTCCCCGNANNACCCCNNAACCCCGGGCGCCGNCGGNCAGANCCCCCACGGGCNAGGAGGGCAAGGGCACCCCNNNNANCCAANCNCAACNNNNGNCNNNAGGCACCCCTACCCCACAGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCTCCTCACATGGTGCCGCCTCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATAGTCAACCCTACTGTCAAGCAGGAGTCTTCCCAGAGTGACATGGGATCCCTCCACAGCTCGAAACTCAGGATAACCAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)