Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL092m10.3                            4 END     2          66       50                paired box protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 71%

 1012796783 Xl3.1-XL045d19.5 - 3 ESTs
                                                                       .........-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL045d19.5                                                                                                                                                                                                                                                                                                                                                                                  CGAGGGGATCCTCCAGANACAAGGTGACATTGGCTACAAGGNAGCTGCTCTGTGGATTTACCAGGGACTCAGAAGAAGATGCCCAACAGCAGCATCAGATCAGAGCTGACCACAGAGAGGGGCTTCTCAGGACCTGCCAGCAATTTCAATATAGGTCACGGAGGTTTGAATCAGTTAGGTGGGGCTTTTGTGAATGGACGACCTCTACCAGAGGTGGTGAGGCAGCGGATTGTTGACCTGGCGCACCAGGGGGTACGTCCCTGTGACATCTCACGACAGCTCAGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATCCGGCCAGGTGTCATTGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCAACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGACAGACGGGGTGTGCGACAATGACACAGTTCCCAGTGTCAGCTCTATCAACAGAATCATACGCACTAAAGTACAGCAACTTTTTAACCTGCCCATGGAGAGCTGTGTAAAATCACTGAGCCCAGGACAAACTCTGATCCCTAGTTCAACAGTGACACCCCCTGAGTCTCCCCATTCAGACTCCCTGGGATCCACGTATTCCATCAGTGGTTTGTTGGGGATCACGCAGCCCAGCGCAGATGGAAAGCGCAAACTTGATGACAGTGACCAGGAGAGCTGCAGGCTGAGTATTGACTCTCAAGGCAGTGTGGGGATCAGTAGGAAACAGCTCCGTACGGAGGCTTATGGGCACCACCCTCTAGACGCCCTGGAGTGTCACTTCCAGAGACAACATTTCCCGGAATCCTACTCTTCTTCCACTCACAGCAAAACAGAACAGGCTCTATATACCCTACCCCTGCTCAACAATTCATTGGATGATGGAAAATCATCACTGACTTCCACAAACACCACAATTGGCAGAAACCTCTCG
                                                  Xl3.1-CHK-1012710245                                                                                                                                                                                                                                                                                                                                                                                        GATCCTCCAGANACAAGGTGACATTGGCTACAAGGNAGCTGCTCTGTGGATTTACCAGGGACTCAGAAGAAGATGCCCAACAGCAGCATCAGATCAGAGCTGACCACAGAGAGGGGCTTCTCAGGACCTGCCAGCAATTTCAATATAGGTCACGGAGGTTTGAATCAGTTAGGTGGGGCTTTTGTGAATGGACGACCTCTACCAGAGGTGGTGAGGCAGCGGATTGTTGACCTGGCGCACCAGGGGGTACGTCCCTGTGACATCTCACGACAGCTCAGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATCCGGCCAGGTGTCATTGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCAACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGACAGACGGGGTGTGCGACAATGACACAGTTCCCAGTGTCAGCTCTATCAACAGAATCATACGCACTAAAGTACAGCAACTTTTTAACCTGCCCATGGAGAGCTGTGTAAAATCACTGAGCCCAGGACAAACTCTGATCCCTAGTTCAACAGTGACACCCCCTGAGTCTCCCCATTCAGACTCCCTGGGATCCACGTATTCCATCAGTGGTTTGTTGGGGATCACGCAGCCCAGCGCAGATGGAAAGCGCAAACTTGATGACAGTGACCAGGAGAGCTGCAGGCTGAGTATTGACTCTCAAGGCAGTGTGGGGATCAGTAGGAAACAGCTCCGTACGGAGGCTTATGGGCACCACCCTCTAGACGCCCTGGAGTGTCACTTCCAGAGACAACATTTCCCGGAATCCTACTCTTCTTCCACTCACAGCAAAACAGAACAGGCTCTATATACCCTACCCCTGCTCAACAATTCATTGGATGATGGAAAATCATCACTGACTTCCACAAACACCACAATTGGCAGAAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                       1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      78     151                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN      78     150                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sp ---- 6e-052     NP_999759.1 paired box protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ==== 6e-055     NP_001024570.1 Variable ABnormal morphology family member (vab-3) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bt ==== 1e-055     NP_001035735.1 paired box gene 6 [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ag ==== 4e-056     XP_311100.4 AGAP000057-PA [Anopheles gambiae str. PEST] ==========================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-058     NP_001014701.1 shaven CG11049-PD, isoform D [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 1e-061     NP_001027652.1 Pax-2/5/8 [Ciona intestinalis] -======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Gg ---- 1e-093     NP_990124.1 paired-box containing protein Pax-2 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Dr ---- 5e-116     XP_001339893.2 PREDICTED: paired box gene 8, partial [Danio rerio] ----===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Cf ==== 2e-134     NP_001003248.1 paired box gene 8 [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 2e-134     NP_039246.1 paired box 8 isoform PAX8C [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = ?? ==== 2e-135     XP_614504.4 PREDICTED: similar to Paired box protein Pax-8 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 4e-136     NP_035170.1 paired box gene 8 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 5e-167     A0JMA6 Paired box protein Pax-8 [Xenopus tropicalis]  =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 8e-176     NP_001081941.1 Pax-8 DNA-binding transcription factor [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL045d19.5                                                                                                                                                                                                                                                                                                                                                                                                          TGA---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2      seed Neu7 5g                              XL045d19.5p                                                                                                                                                                                                                                                                                                                                                                                  CGAGGGGATCCTCCAGANACAAGGTGACATTGGCTACAAGGNAGCTGCTCTGTGGATTTACCAGGGACTCAGAAGAAGATGCCCAACAGCAGCATCAGATCAGAGCTGACCACAGAGAGGGGCTTCTCAGGACCTGCCAGCAATTTCAATATAGGTCACGGAGGTTTGAATCAGTTAGGTGGGGCTTTTGTGAATGGACGACCTCTACCAGAGGTGGTGAGGCAGCGGATTGTTGACCTGGCGCACCAGGGGGTACGTCCCTGTGACATCTCACGACAGCTCAGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATCCGGCCAGGTGTCATTGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCAACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGACAGACGGGGTGTGCGACAATGACACAGTTCCCAGTGTCAGCTCTATCAACAGAATCATACGCACTAAAGTACAGCAACTTTTTAACCTGCCCATGGAGAGCTGTGTAAAATCACTGAGCCCAGGACAAACTCTGATCCCTAGTTCAACAGTGACAC
  5   1   2       bld Neu7      out                        XL044l19.5p                                                                                                                                                                                                                                                                                                                                                                                                 GTGACATTGGCTACAAGGNAGCTGCTCTGTGGNATTTACCAGGGNACTCAGNAAGAAGNATGCCCAACAGCAGCATCAGNATCAGAGCTGACCACAGNAGNAGGGGCTTCTCAGGACCTGCCAGCAATTTCAATATAGGTCACGGNAGGTTTGAATCAGTTAGGTGGGGCTTTTGTGAATGGACGACCTCTACCAGAGGTGGTGAGGCAGCGGATTGTTGACCTGGCGCACCAGGGGGTACGTCCCTGTGACATCTCACGACAGCTCAGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATCCGGCCAGGTGTCATTGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCAACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGACAGACGGGGTGTGCGACAATGACACAGTTCCCAGTGTCAGCTCTATCAACAGAATCATACGCACTAAAGTACAGCAACTTTTTAACCTGCCCATGGAGAGCT
  5   1   2       bld Tbd7      out                        XL092m10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCAACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGACAGACGGGGTGTGCGACAATGACACAGTTCCCAGTGTCAGCTCTATCAACAGAATCATACGCACTAAAGTACAGCAACTTTTTAACCTGCCCATGGAGAGCTGTGTAAAATCACTGAGCCCAGGACAAACTCTGATCCCTAGTTCAACAGTGACACCCCCTGAGTCTCCCCATTCAGACTCCCTGGGATCCACGTATTCCATCAGTGGTTTGTTGGGGATCACGCAGCCCAGCGCAGATGGAAAGCGCAAACTTGATGACAGTGACCAGGAGAGCTGCAGGCTGAGTATTGACTCTCAAGGCAGTGTGGGGATCAGTAGGAAACAGCTCCGTACGGAGGCTTATGGGCACCACCCTCTAGACGCCCTGGAGTGTCACTTCCAGAGACAACATTTCCCGGAATCCTACTCTTCTTCCACTCACAGCAAAACAGAACAGGCTCTATATACCCTACCCCTGCTCAACAATTCATTGGATGATGGAAAATCATCACTGACTTCCACAAACACCACAATTGGCAGAAACCTCTCGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)